ID: 1071909659

View in Genome Browser
Species Human (GRCh38)
Location 10:90217148-90217170
Sequence AGTAGCTTTCCCCATGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071909652_1071909659 21 Left 1071909652 10:90217104-90217126 CCATCGTCTGTCTTCCTCTAGAT No data
Right 1071909659 10:90217148-90217170 AGTAGCTTTCCCCATGGGGTGGG No data
1071909654_1071909659 7 Left 1071909654 10:90217118-90217140 CCTCTAGATCTATTGGCTTCATT No data
Right 1071909659 10:90217148-90217170 AGTAGCTTTCCCCATGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071909659 Original CRISPR AGTAGCTTTCCCCATGGGGT GGG Intergenic
No off target data available for this crispr