ID: 1071921045

View in Genome Browser
Species Human (GRCh38)
Location 10:90350963-90350985
Sequence GGCCAAGAATAGATGGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071921045_1071921051 28 Left 1071921045 10:90350963-90350985 CCATGTACCATCTATTCTTGGCC No data
Right 1071921051 10:90351014-90351036 GGCCTATAATTCCATACTAGAGG No data
1071921045_1071921050 7 Left 1071921045 10:90350963-90350985 CCATGTACCATCTATTCTTGGCC No data
Right 1071921050 10:90350993-90351015 ACTAGGTCATTGCTCTGGAGAGG No data
1071921045_1071921047 -10 Left 1071921045 10:90350963-90350985 CCATGTACCATCTATTCTTGGCC No data
Right 1071921047 10:90350976-90350998 ATTCTTGGCCAAATTAAACTAGG No data
1071921045_1071921049 2 Left 1071921045 10:90350963-90350985 CCATGTACCATCTATTCTTGGCC No data
Right 1071921049 10:90350988-90351010 ATTAAACTAGGTCATTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071921045 Original CRISPR GGCCAAGAATAGATGGTACA TGG (reversed) Intergenic
No off target data available for this crispr