ID: 1071921916

View in Genome Browser
Species Human (GRCh38)
Location 10:90360091-90360113
Sequence CATGCCTCCTGTACAGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071921916_1071921925 24 Left 1071921916 10:90360091-90360113 CCATGGGCTGTACAGGAGGCATG No data
Right 1071921925 10:90360138-90360160 CAATTATTGCAGAAGGTGAATGG No data
1071921916_1071921924 17 Left 1071921916 10:90360091-90360113 CCATGGGCTGTACAGGAGGCATG No data
Right 1071921924 10:90360131-90360153 AAACTTACAATTATTGCAGAAGG No data
1071921916_1071921922 -6 Left 1071921916 10:90360091-90360113 CCATGGGCTGTACAGGAGGCATG No data
Right 1071921922 10:90360108-90360130 GGCATGGCTGGGGAGGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071921916 Original CRISPR CATGCCTCCTGTACAGCCCA TGG (reversed) Intergenic
No off target data available for this crispr