ID: 1071921922

View in Genome Browser
Species Human (GRCh38)
Location 10:90360108-90360130
Sequence GGCATGGCTGGGGAGGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071921916_1071921922 -6 Left 1071921916 10:90360091-90360113 CCATGGGCTGTACAGGAGGCATG No data
Right 1071921922 10:90360108-90360130 GGCATGGCTGGGGAGGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071921922 Original CRISPR GGCATGGCTGGGGAGGCCAC AGG Intergenic
No off target data available for this crispr