ID: 1071921923

View in Genome Browser
Species Human (GRCh38)
Location 10:90360124-90360146
Sequence CAATAATTGTAAGTTTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22855
Summary {0: 7, 1: 603, 2: 6974, 3: 8695, 4: 6576}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071921923_1071921929 22 Left 1071921923 10:90360124-90360146 CCACAGGAAACTTACAATTATTG 0: 7
1: 603
2: 6974
3: 8695
4: 6576
Right 1071921929 10:90360169-90360191 CACATCTTCACATGGCTGGCAGG No data
1071921923_1071921928 18 Left 1071921923 10:90360124-90360146 CCACAGGAAACTTACAATTATTG 0: 7
1: 603
2: 6974
3: 8695
4: 6576
Right 1071921928 10:90360165-90360187 AAGGCACATCTTCACATGGCTGG No data
1071921923_1071921925 -9 Left 1071921923 10:90360124-90360146 CCACAGGAAACTTACAATTATTG 0: 7
1: 603
2: 6974
3: 8695
4: 6576
Right 1071921925 10:90360138-90360160 CAATTATTGCAGAAGGTGAATGG No data
1071921923_1071921927 14 Left 1071921923 10:90360124-90360146 CCACAGGAAACTTACAATTATTG 0: 7
1: 603
2: 6974
3: 8695
4: 6576
Right 1071921927 10:90360161-90360183 AAAGAAGGCACATCTTCACATGG No data
1071921923_1071921926 -1 Left 1071921923 10:90360124-90360146 CCACAGGAAACTTACAATTATTG 0: 7
1: 603
2: 6974
3: 8695
4: 6576
Right 1071921926 10:90360146-90360168 GCAGAAGGTGAATGGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071921923 Original CRISPR CAATAATTGTAAGTTTCCTG TGG (reversed) Intergenic
Too many off-targets to display for this crispr