ID: 1071921925 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:90360138-90360160 |
Sequence | CAATTATTGCAGAAGGTGAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1071921916_1071921925 | 24 | Left | 1071921916 | 10:90360091-90360113 | CCATGGGCTGTACAGGAGGCATG | No data | ||
Right | 1071921925 | 10:90360138-90360160 | CAATTATTGCAGAAGGTGAATGG | No data | ||||
1071921923_1071921925 | -9 | Left | 1071921923 | 10:90360124-90360146 | CCACAGGAAACTTACAATTATTG | 0: 7 1: 603 2: 6974 3: 8695 4: 6576 |
||
Right | 1071921925 | 10:90360138-90360160 | CAATTATTGCAGAAGGTGAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1071921925 | Original CRISPR | CAATTATTGCAGAAGGTGAA TGG | Intergenic | ||
No off target data available for this crispr |