ID: 1071921925

View in Genome Browser
Species Human (GRCh38)
Location 10:90360138-90360160
Sequence CAATTATTGCAGAAGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071921916_1071921925 24 Left 1071921916 10:90360091-90360113 CCATGGGCTGTACAGGAGGCATG No data
Right 1071921925 10:90360138-90360160 CAATTATTGCAGAAGGTGAATGG No data
1071921923_1071921925 -9 Left 1071921923 10:90360124-90360146 CCACAGGAAACTTACAATTATTG 0: 7
1: 603
2: 6974
3: 8695
4: 6576
Right 1071921925 10:90360138-90360160 CAATTATTGCAGAAGGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071921925 Original CRISPR CAATTATTGCAGAAGGTGAA TGG Intergenic
No off target data available for this crispr