ID: 1071923156

View in Genome Browser
Species Human (GRCh38)
Location 10:90374390-90374412
Sequence CACAATGAGCCTGGCTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071923156_1071923161 0 Left 1071923156 10:90374390-90374412 CCAGGTCAGCCAGGCTCATTGTG No data
Right 1071923161 10:90374413-90374435 CTCATTGAAGCCATCCTTGGGGG No data
1071923156_1071923163 12 Left 1071923156 10:90374390-90374412 CCAGGTCAGCCAGGCTCATTGTG No data
Right 1071923163 10:90374425-90374447 ATCCTTGGGGGACTTTGAGCAGG No data
1071923156_1071923158 -3 Left 1071923156 10:90374390-90374412 CCAGGTCAGCCAGGCTCATTGTG No data
Right 1071923158 10:90374410-90374432 GTGCTCATTGAAGCCATCCTTGG No data
1071923156_1071923160 -1 Left 1071923156 10:90374390-90374412 CCAGGTCAGCCAGGCTCATTGTG No data
Right 1071923160 10:90374412-90374434 GCTCATTGAAGCCATCCTTGGGG No data
1071923156_1071923159 -2 Left 1071923156 10:90374390-90374412 CCAGGTCAGCCAGGCTCATTGTG No data
Right 1071923159 10:90374411-90374433 TGCTCATTGAAGCCATCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071923156 Original CRISPR CACAATGAGCCTGGCTGACC TGG (reversed) Intergenic
No off target data available for this crispr