ID: 1071923159

View in Genome Browser
Species Human (GRCh38)
Location 10:90374411-90374433
Sequence TGCTCATTGAAGCCATCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071923156_1071923159 -2 Left 1071923156 10:90374390-90374412 CCAGGTCAGCCAGGCTCATTGTG No data
Right 1071923159 10:90374411-90374433 TGCTCATTGAAGCCATCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071923159 Original CRISPR TGCTCATTGAAGCCATCCTT GGG Intergenic
No off target data available for this crispr