ID: 1071923160 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:90374412-90374434 |
Sequence | GCTCATTGAAGCCATCCTTG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1071923157_1071923160 | -10 | Left | 1071923157 | 10:90374399-90374421 | CCAGGCTCATTGTGCTCATTGAA | No data | ||
Right | 1071923160 | 10:90374412-90374434 | GCTCATTGAAGCCATCCTTGGGG | No data | ||||
1071923156_1071923160 | -1 | Left | 1071923156 | 10:90374390-90374412 | CCAGGTCAGCCAGGCTCATTGTG | No data | ||
Right | 1071923160 | 10:90374412-90374434 | GCTCATTGAAGCCATCCTTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1071923160 | Original CRISPR | GCTCATTGAAGCCATCCTTG GGG | Intergenic | ||