ID: 1071923161

View in Genome Browser
Species Human (GRCh38)
Location 10:90374413-90374435
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071923156_1071923161 0 Left 1071923156 10:90374390-90374412 CCAGGTCAGCCAGGCTCATTGTG No data
Right 1071923161 10:90374413-90374435 CTCATTGAAGCCATCCTTGGGGG No data
1071923157_1071923161 -9 Left 1071923157 10:90374399-90374421 CCAGGCTCATTGTGCTCATTGAA No data
Right 1071923161 10:90374413-90374435 CTCATTGAAGCCATCCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071923161 Original CRISPR CTCATTGAAGCCATCCTTGG GGG Intergenic
No off target data available for this crispr