ID: 1071928180

View in Genome Browser
Species Human (GRCh38)
Location 10:90435599-90435621
Sequence AACAAGGTGGTGCCTCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071928177_1071928180 2 Left 1071928177 10:90435574-90435596 CCTGAATTAGTTCTCATAAATTT No data
Right 1071928180 10:90435599-90435621 AACAAGGTGGTGCCTCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071928180 Original CRISPR AACAAGGTGGTGCCTCCAGA AGG Intergenic
No off target data available for this crispr