ID: 1071930030

View in Genome Browser
Species Human (GRCh38)
Location 10:90458632-90458654
Sequence TCTTTATTGTCCCCAAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071930030_1071930037 25 Left 1071930030 10:90458632-90458654 CCAGGCTTTGGGGACAATAAAGA No data
Right 1071930037 10:90458680-90458702 CGTCCTCACTCTTATTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071930030 Original CRISPR TCTTTATTGTCCCCAAAGCC TGG (reversed) Intergenic
No off target data available for this crispr