ID: 1071931012

View in Genome Browser
Species Human (GRCh38)
Location 10:90470360-90470382
Sequence CACTCACTCAGGAGGCTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071931007_1071931012 3 Left 1071931007 10:90470334-90470356 CCAAAATCAAAACATCTGCCTGG No data
Right 1071931012 10:90470360-90470382 CACTCACTCAGGAGGCTCTAAGG No data
1071931006_1071931012 23 Left 1071931006 10:90470314-90470336 CCAAAATCTGTTTCACTGGGCCA No data
Right 1071931012 10:90470360-90470382 CACTCACTCAGGAGGCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071931012 Original CRISPR CACTCACTCAGGAGGCTCTA AGG Intergenic
No off target data available for this crispr