ID: 1071937690

View in Genome Browser
Species Human (GRCh38)
Location 10:90549312-90549334
Sequence GACAGCTCTTGGCCTGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071937688_1071937690 11 Left 1071937688 10:90549278-90549300 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 1071937690 10:90549312-90549334 GACAGCTCTTGGCCTGTTCCTGG No data
1071937686_1071937690 16 Left 1071937686 10:90549273-90549295 CCCTTCCATCTTCTGCAGATAAC No data
Right 1071937690 10:90549312-90549334 GACAGCTCTTGGCCTGTTCCTGG No data
1071937687_1071937690 15 Left 1071937687 10:90549274-90549296 CCTTCCATCTTCTGCAGATAACT 0: 5
1: 198
2: 191
3: 123
4: 339
Right 1071937690 10:90549312-90549334 GACAGCTCTTGGCCTGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071937690 Original CRISPR GACAGCTCTTGGCCTGTTCC TGG Intergenic
No off target data available for this crispr