ID: 1071940988

View in Genome Browser
Species Human (GRCh38)
Location 10:90591745-90591767
Sequence TACCTAAGTATGCAACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071940988_1071940992 20 Left 1071940988 10:90591745-90591767 CCTGTCTGTTGCATACTTAGGTA No data
Right 1071940992 10:90591788-90591810 AGGAAGCCAGAGTGCACAGCGGG No data
1071940988_1071940993 23 Left 1071940988 10:90591745-90591767 CCTGTCTGTTGCATACTTAGGTA No data
Right 1071940993 10:90591791-90591813 AAGCCAGAGTGCACAGCGGGAGG No data
1071940988_1071940991 19 Left 1071940988 10:90591745-90591767 CCTGTCTGTTGCATACTTAGGTA No data
Right 1071940991 10:90591787-90591809 TAGGAAGCCAGAGTGCACAGCGG No data
1071940988_1071940990 0 Left 1071940988 10:90591745-90591767 CCTGTCTGTTGCATACTTAGGTA No data
Right 1071940990 10:90591768-90591790 AGCAGTTGGAAGTTGCATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071940988 Original CRISPR TACCTAAGTATGCAACAGAC AGG (reversed) Intergenic
No off target data available for this crispr