ID: 1071941661

View in Genome Browser
Species Human (GRCh38)
Location 10:90597770-90597792
Sequence CAGGGGACTGCATTTAGTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071941661_1071941666 10 Left 1071941661 10:90597770-90597792 CCTCGACTAAATGCAGTCCCCTG No data
Right 1071941666 10:90597803-90597825 TCTAATCTCTTCCCTCACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071941661 Original CRISPR CAGGGGACTGCATTTAGTCG AGG (reversed) Intergenic
No off target data available for this crispr