ID: 1071941666

View in Genome Browser
Species Human (GRCh38)
Location 10:90597803-90597825
Sequence TCTAATCTCTTCCCTCACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071941658_1071941666 25 Left 1071941658 10:90597755-90597777 CCTTGAAATCACTCCCCTCGACT No data
Right 1071941666 10:90597803-90597825 TCTAATCTCTTCCCTCACTATGG No data
1071941663_1071941666 -8 Left 1071941663 10:90597788-90597810 CCCTGTTCTCTCCTTTCTAATCT No data
Right 1071941666 10:90597803-90597825 TCTAATCTCTTCCCTCACTATGG No data
1071941657_1071941666 28 Left 1071941657 10:90597752-90597774 CCTCCTTGAAATCACTCCCCTCG No data
Right 1071941666 10:90597803-90597825 TCTAATCTCTTCCCTCACTATGG No data
1071941664_1071941666 -9 Left 1071941664 10:90597789-90597811 CCTGTTCTCTCCTTTCTAATCTC No data
Right 1071941666 10:90597803-90597825 TCTAATCTCTTCCCTCACTATGG No data
1071941661_1071941666 10 Left 1071941661 10:90597770-90597792 CCTCGACTAAATGCAGTCCCCTG No data
Right 1071941666 10:90597803-90597825 TCTAATCTCTTCCCTCACTATGG No data
1071941662_1071941666 -7 Left 1071941662 10:90597787-90597809 CCCCTGTTCTCTCCTTTCTAATC No data
Right 1071941666 10:90597803-90597825 TCTAATCTCTTCCCTCACTATGG No data
1071941659_1071941666 12 Left 1071941659 10:90597768-90597790 CCCCTCGACTAAATGCAGTCCCC No data
Right 1071941666 10:90597803-90597825 TCTAATCTCTTCCCTCACTATGG No data
1071941660_1071941666 11 Left 1071941660 10:90597769-90597791 CCCTCGACTAAATGCAGTCCCCT No data
Right 1071941666 10:90597803-90597825 TCTAATCTCTTCCCTCACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071941666 Original CRISPR TCTAATCTCTTCCCTCACTA TGG Intergenic
No off target data available for this crispr