ID: 1071944324

View in Genome Browser
Species Human (GRCh38)
Location 10:90624513-90624535
Sequence CTAAAACACATGTAGATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071944323_1071944324 19 Left 1071944323 10:90624471-90624493 CCAATCTAGAACACATGGTATCA No data
Right 1071944324 10:90624513-90624535 CTAAAACACATGTAGATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071944324 Original CRISPR CTAAAACACATGTAGATTAA AGG Intergenic
No off target data available for this crispr