ID: 1071946653

View in Genome Browser
Species Human (GRCh38)
Location 10:90653485-90653507
Sequence GTGTGTGAGGGGAAGCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071946653_1071946657 1 Left 1071946653 10:90653485-90653507 CCTTGCAGCTTCCCCTCACACAC No data
Right 1071946657 10:90653509-90653531 CTCCCTTATTTTCTGAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071946653 Original CRISPR GTGTGTGAGGGGAAGCTGCA AGG (reversed) Intergenic
No off target data available for this crispr