ID: 1071947084

View in Genome Browser
Species Human (GRCh38)
Location 10:90657695-90657717
Sequence GATAGCTCTTGGTCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071947084_1071947087 4 Left 1071947084 10:90657695-90657717 CCAGTAGCAGACCAAGAGCTATC No data
Right 1071947087 10:90657722-90657744 AAAAGGAAAATAGTTATCTATGG No data
1071947084_1071947089 15 Left 1071947084 10:90657695-90657717 CCAGTAGCAGACCAAGAGCTATC No data
Right 1071947089 10:90657733-90657755 AGTTATCTATGGATAAAGGCAGG No data
1071947084_1071947088 11 Left 1071947084 10:90657695-90657717 CCAGTAGCAGACCAAGAGCTATC No data
Right 1071947088 10:90657729-90657751 AAATAGTTATCTATGGATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071947084 Original CRISPR GATAGCTCTTGGTCTGCTAC TGG (reversed) Intergenic
No off target data available for this crispr