ID: 1071949094

View in Genome Browser
Species Human (GRCh38)
Location 10:90682691-90682713
Sequence GGTGTGTGTATATGGGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071949094_1071949106 24 Left 1071949094 10:90682691-90682713 CCTCCACCCCATATACACACACC No data
Right 1071949106 10:90682738-90682760 TGCTTAACACCACTGGAAGCAGG No data
1071949094_1071949107 25 Left 1071949094 10:90682691-90682713 CCTCCACCCCATATACACACACC No data
Right 1071949107 10:90682739-90682761 GCTTAACACCACTGGAAGCAGGG No data
1071949094_1071949103 17 Left 1071949094 10:90682691-90682713 CCTCCACCCCATATACACACACC No data
Right 1071949103 10:90682731-90682753 TTCCCATTGCTTAACACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071949094 Original CRISPR GGTGTGTGTATATGGGGTGG AGG (reversed) Intergenic