ID: 1071949096

View in Genome Browser
Species Human (GRCh38)
Location 10:90682697-90682719
Sequence GAAGAAGGTGTGTGTATATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071949096_1071949110 30 Left 1071949096 10:90682697-90682719 CCCCATATACACACACCTTCTTC No data
Right 1071949110 10:90682750-90682772 CTGGAAGCAGGGTGACTACTGGG No data
1071949096_1071949107 19 Left 1071949096 10:90682697-90682719 CCCCATATACACACACCTTCTTC No data
Right 1071949107 10:90682739-90682761 GCTTAACACCACTGGAAGCAGGG No data
1071949096_1071949103 11 Left 1071949096 10:90682697-90682719 CCCCATATACACACACCTTCTTC No data
Right 1071949103 10:90682731-90682753 TTCCCATTGCTTAACACCACTGG No data
1071949096_1071949109 29 Left 1071949096 10:90682697-90682719 CCCCATATACACACACCTTCTTC No data
Right 1071949109 10:90682749-90682771 ACTGGAAGCAGGGTGACTACTGG No data
1071949096_1071949106 18 Left 1071949096 10:90682697-90682719 CCCCATATACACACACCTTCTTC No data
Right 1071949106 10:90682738-90682760 TGCTTAACACCACTGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071949096 Original CRISPR GAAGAAGGTGTGTGTATATG GGG (reversed) Intergenic
No off target data available for this crispr