ID: 1071949099

View in Genome Browser
Species Human (GRCh38)
Location 10:90682712-90682734
Sequence GGAAGGGGAAGAAGTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071949099_1071949106 3 Left 1071949099 10:90682712-90682734 CCTTCTTCACTTCTTCCCCTTCC No data
Right 1071949106 10:90682738-90682760 TGCTTAACACCACTGGAAGCAGG No data
1071949099_1071949111 20 Left 1071949099 10:90682712-90682734 CCTTCTTCACTTCTTCCCCTTCC No data
Right 1071949111 10:90682755-90682777 AGCAGGGTGACTACTGGGATTGG No data
1071949099_1071949110 15 Left 1071949099 10:90682712-90682734 CCTTCTTCACTTCTTCCCCTTCC No data
Right 1071949110 10:90682750-90682772 CTGGAAGCAGGGTGACTACTGGG No data
1071949099_1071949103 -4 Left 1071949099 10:90682712-90682734 CCTTCTTCACTTCTTCCCCTTCC No data
Right 1071949103 10:90682731-90682753 TTCCCATTGCTTAACACCACTGG No data
1071949099_1071949107 4 Left 1071949099 10:90682712-90682734 CCTTCTTCACTTCTTCCCCTTCC No data
Right 1071949107 10:90682739-90682761 GCTTAACACCACTGGAAGCAGGG No data
1071949099_1071949109 14 Left 1071949099 10:90682712-90682734 CCTTCTTCACTTCTTCCCCTTCC No data
Right 1071949109 10:90682749-90682771 ACTGGAAGCAGGGTGACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071949099 Original CRISPR GGAAGGGGAAGAAGTGAAGA AGG (reversed) Intergenic
No off target data available for this crispr