ID: 1071949103

View in Genome Browser
Species Human (GRCh38)
Location 10:90682731-90682753
Sequence TTCCCATTGCTTAACACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071949098_1071949103 9 Left 1071949098 10:90682699-90682721 CCATATACACACACCTTCTTCAC No data
Right 1071949103 10:90682731-90682753 TTCCCATTGCTTAACACCACTGG No data
1071949097_1071949103 10 Left 1071949097 10:90682698-90682720 CCCATATACACACACCTTCTTCA No data
Right 1071949103 10:90682731-90682753 TTCCCATTGCTTAACACCACTGG No data
1071949092_1071949103 29 Left 1071949092 10:90682679-90682701 CCTCCTTCTACTCCTCCACCCCA No data
Right 1071949103 10:90682731-90682753 TTCCCATTGCTTAACACCACTGG No data
1071949094_1071949103 17 Left 1071949094 10:90682691-90682713 CCTCCACCCCATATACACACACC No data
Right 1071949103 10:90682731-90682753 TTCCCATTGCTTAACACCACTGG No data
1071949095_1071949103 14 Left 1071949095 10:90682694-90682716 CCACCCCATATACACACACCTTC No data
Right 1071949103 10:90682731-90682753 TTCCCATTGCTTAACACCACTGG No data
1071949099_1071949103 -4 Left 1071949099 10:90682712-90682734 CCTTCTTCACTTCTTCCCCTTCC No data
Right 1071949103 10:90682731-90682753 TTCCCATTGCTTAACACCACTGG No data
1071949096_1071949103 11 Left 1071949096 10:90682697-90682719 CCCCATATACACACACCTTCTTC No data
Right 1071949103 10:90682731-90682753 TTCCCATTGCTTAACACCACTGG No data
1071949093_1071949103 26 Left 1071949093 10:90682682-90682704 CCTTCTACTCCTCCACCCCATAT No data
Right 1071949103 10:90682731-90682753 TTCCCATTGCTTAACACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071949103 Original CRISPR TTCCCATTGCTTAACACCAC TGG Intergenic
No off target data available for this crispr