ID: 1071950802

View in Genome Browser
Species Human (GRCh38)
Location 10:90700939-90700961
Sequence AGTTATCTGTGGATGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071950795_1071950802 16 Left 1071950795 10:90700900-90700922 CCCAGCACCAGGCCAAAAGCTGT No data
Right 1071950802 10:90700939-90700961 AGTTATCTGTGGATGATGGCAGG No data
1071950797_1071950802 9 Left 1071950797 10:90700907-90700929 CCAGGCCAAAAGCTGTCTTTCAA No data
Right 1071950802 10:90700939-90700961 AGTTATCTGTGGATGATGGCAGG No data
1071950796_1071950802 15 Left 1071950796 10:90700901-90700923 CCAGCACCAGGCCAAAAGCTGTC No data
Right 1071950802 10:90700939-90700961 AGTTATCTGTGGATGATGGCAGG No data
1071950799_1071950802 4 Left 1071950799 10:90700912-90700934 CCAAAAGCTGTCTTTCAAAAGGA No data
Right 1071950802 10:90700939-90700961 AGTTATCTGTGGATGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071950802 Original CRISPR AGTTATCTGTGGATGATGGC AGG Intergenic
No off target data available for this crispr