ID: 1071953291

View in Genome Browser
Species Human (GRCh38)
Location 10:90729088-90729110
Sequence ACTGGGATTCTGTTTCTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071953291_1071953300 3 Left 1071953291 10:90729088-90729110 CCTGTAAGAAACAGAATCCCAGT No data
Right 1071953300 10:90729114-90729136 AGGAGGTCATGGAGCTTAGGGGG No data
1071953291_1071953298 1 Left 1071953291 10:90729088-90729110 CCTGTAAGAAACAGAATCCCAGT No data
Right 1071953298 10:90729112-90729134 GTAGGAGGTCATGGAGCTTAGGG No data
1071953291_1071953302 23 Left 1071953291 10:90729088-90729110 CCTGTAAGAAACAGAATCCCAGT No data
Right 1071953302 10:90729134-90729156 GGGTCTTGGAAGAAGTTATCTGG No data
1071953291_1071953299 2 Left 1071953291 10:90729088-90729110 CCTGTAAGAAACAGAATCCCAGT No data
Right 1071953299 10:90729113-90729135 TAGGAGGTCATGGAGCTTAGGGG No data
1071953291_1071953301 9 Left 1071953291 10:90729088-90729110 CCTGTAAGAAACAGAATCCCAGT No data
Right 1071953301 10:90729120-90729142 TCATGGAGCTTAGGGGGTCTTGG No data
1071953291_1071953297 0 Left 1071953291 10:90729088-90729110 CCTGTAAGAAACAGAATCCCAGT No data
Right 1071953297 10:90729111-90729133 AGTAGGAGGTCATGGAGCTTAGG No data
1071953291_1071953294 -8 Left 1071953291 10:90729088-90729110 CCTGTAAGAAACAGAATCCCAGT No data
Right 1071953294 10:90729103-90729125 ATCCCAGTAGTAGGAGGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071953291 Original CRISPR ACTGGGATTCTGTTTCTTAC AGG (reversed) Intergenic
No off target data available for this crispr