ID: 1071958457

View in Genome Browser
Species Human (GRCh38)
Location 10:90784425-90784447
Sequence TATAATAATTCCTCCCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071958455_1071958457 -2 Left 1071958455 10:90784404-90784426 CCCTCATCTGCACAATGGAAATA No data
Right 1071958457 10:90784425-90784447 TATAATAATTCCTCCCCTACAGG No data
1071958456_1071958457 -3 Left 1071958456 10:90784405-90784427 CCTCATCTGCACAATGGAAATAT No data
Right 1071958457 10:90784425-90784447 TATAATAATTCCTCCCCTACAGG No data
1071958452_1071958457 23 Left 1071958452 10:90784379-90784401 CCACTTCATCTCTTGGACTGTCT 0: 1
1: 0
2: 2
3: 24
4: 248
Right 1071958457 10:90784425-90784447 TATAATAATTCCTCCCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071958457 Original CRISPR TATAATAATTCCTCCCCTAC AGG Intronic
No off target data available for this crispr