ID: 1071960098

View in Genome Browser
Species Human (GRCh38)
Location 10:90801788-90801810
Sequence CTGTTCAATCAGATTGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071960098_1071960102 21 Left 1071960098 10:90801788-90801810 CCTTGTGCAATCTGATTGAACAG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1071960102 10:90801832-90801854 GTCTCAAAGTTTTGATTATTGGG No data
1071960098_1071960104 30 Left 1071960098 10:90801788-90801810 CCTTGTGCAATCTGATTGAACAG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1071960104 10:90801841-90801863 TTTTGATTATTGGGAAAAAAGGG No data
1071960098_1071960101 20 Left 1071960098 10:90801788-90801810 CCTTGTGCAATCTGATTGAACAG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1071960101 10:90801831-90801853 TGTCTCAAAGTTTTGATTATTGG No data
1071960098_1071960103 29 Left 1071960098 10:90801788-90801810 CCTTGTGCAATCTGATTGAACAG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1071960103 10:90801840-90801862 GTTTTGATTATTGGGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071960098 Original CRISPR CTGTTCAATCAGATTGCACA AGG (reversed) Intronic
904978751 1:34479036-34479058 CTGTTCCATCAGAGTGGAGAAGG - Intergenic
908630722 1:66103731-66103753 AAGTTCCAACAGATTGCACAGGG - Intronic
914236284 1:145814844-145814866 CTGTACATTCAAATTTCACATGG + Intronic
914391335 1:147225741-147225763 CTGTTCAAACAGATTGTAGCAGG + Intronic
916880319 1:169014330-169014352 CTGGTCAATCATCTTGAACATGG - Intergenic
916935413 1:169623189-169623211 CTATTCAGACAGATTGCAGAAGG + Intronic
917687307 1:177430410-177430432 ATGGTGAATCAGATTGCAGAGGG - Intergenic
922700057 1:227754040-227754062 CAGAAGAATCAGATTGCACATGG + Intronic
923364074 1:233242454-233242476 CTTTCCAATCAGATTTCACTGGG + Intronic
924127410 1:240869555-240869577 CTCTTCATTCACATTGCATATGG - Intronic
1063585217 10:7346188-7346210 CGATTCAATCACTTTGCACAAGG - Intronic
1064144431 10:12816227-12816249 CTGTTCAAAAAGAAGGCACAAGG - Intronic
1071960098 10:90801788-90801810 CTGTTCAATCAGATTGCACAAGG - Intronic
1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG + Intergenic
1075368020 10:121910139-121910161 CTATTCAATAAAATTGCAAATGG + Intronic
1077371083 11:2181958-2181980 CTCCCCAATCTGATTGCACAGGG - Intergenic
1092359755 12:7826355-7826377 CTGTTTTATCAGAATGTACAAGG - Intronic
1093428158 12:19052683-19052705 CTGGTTACTCAGATAGCACATGG + Intergenic
1097556373 12:61143901-61143923 CTGTTCCTTCAGCTTGCAGATGG + Intergenic
1097685507 12:62687220-62687242 CTGTTCAATCATTCTGCTCATGG + Intronic
1110555483 13:76854870-76854892 CTGTTCTAAGAGATTGCAGAAGG + Intergenic
1112235424 13:97631464-97631486 CTGATCAATCAGAATGGACATGG - Intergenic
1112429714 13:99340521-99340543 ATGTTCTCTCAGTTTGCACAAGG + Exonic
1117492645 14:56266707-56266729 TTGTTCAATCAAATGGTACATGG - Intronic
1124716558 15:32068338-32068360 CTACTTTATCAGATTGCACATGG + Intronic
1130080970 15:80733125-80733147 CTCTGCAATCAGACAGCACAAGG - Intronic
1134246112 16:12541380-12541402 CTGTACAATGAGCCTGCACATGG - Intronic
1141583871 16:85019953-85019975 CTGTACAAAGAGATTTCACAGGG - Intergenic
1144294953 17:13865394-13865416 CTGTTGAATCAAATTCCAAAAGG - Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1150584366 17:66504282-66504304 TTGTACTATAAGATTGCACAGGG + Intronic
1152768424 17:82153200-82153222 CTGGTAAAACAGATTGCAGATGG + Intronic
1156671940 18:39481402-39481424 CTGAGTAATCATATTGCACAGGG + Intergenic
1159242358 18:65758619-65758641 AAGTTCTATCAGAGTGCACAAGG - Intronic
1162828067 19:13266431-13266453 CTGTACATCCAGGTTGCACATGG + Intronic
1165683852 19:37800820-37800842 CTGCTGAAACAGATTGCACGAGG - Intronic
1166274083 19:41739441-41739463 CTGCTTGACCAGATTGCACAGGG + Intronic
1166577473 19:43855875-43855897 CTGTTCAATCAGGTGGCATTTGG - Intergenic
1167401284 19:49272187-49272209 CTGTAGAATCACATTGCAGAGGG - Intergenic
928183739 2:29090645-29090667 CTGCTAAATCACATTCCACAAGG - Intergenic
928426713 2:31184508-31184530 CTGTTCAATCAAATTGCATCTGG - Intronic
933765957 2:85709987-85710009 CTGATGAATGAGAATGCACATGG + Intergenic
936680008 2:114759266-114759288 CTGTTTAGTCAGACTGCAAATGG - Intronic
940905131 2:159162284-159162306 CTGTTAAATGGGAGTGCACAGGG - Intronic
942869400 2:180716504-180716526 TTGCTAAATCAGATTGCTCAGGG - Intergenic
946244368 2:218378247-218378269 CTGTGCAATCCTATTGCTCACGG - Intergenic
947514621 2:230791244-230791266 CTGTTTCATCACATTGGACATGG + Intronic
1171494514 20:25546282-25546304 CTGTTCAGTCAGAATCCACCTGG - Intronic
1174197625 20:48784844-48784866 TACTTCAATGAGATTGCACAAGG - Intronic
1177091469 21:16774380-16774402 CTGTTTAATCTTAATGCACATGG + Intergenic
1177613117 21:23479789-23479811 CTGTTCACTCAGATTTCCCCAGG - Intergenic
1177684353 21:24417395-24417417 CCGTTTAACCAGTTTGCACAGGG - Intergenic
1178164956 21:29962910-29962932 CTTTACAATCAAATTGCACTTGG + Intergenic
1179322928 21:40310149-40310171 TTGTACATTCAGATTGCATAGGG - Intronic
1180985058 22:19899190-19899212 CTGTTCAAACAGCTTGCCCCAGG + Intronic
1181591902 22:23890448-23890470 CTGATCATTCAGAGTGCTCATGG + Intronic
955372726 3:58367645-58367667 TTGTTCAATCACATTCTACATGG - Intronic
955520045 3:59767060-59767082 CTGTTCTTTCACATTGCAAATGG + Intronic
956008114 3:64802086-64802108 TGGTTCCATTAGATTGCACACGG - Intergenic
956644035 3:71439061-71439083 CTGTTTCATTAAATTGCACAAGG + Intronic
958066913 3:88555484-88555506 GAGTTCAATCACATCGCACAGGG - Intergenic
958067358 3:88560540-88560562 CTGTTGAATTAGATGACACATGG - Intergenic
960124162 3:113979993-113980015 CTGTGAAATCACATTGCAAAGGG - Intronic
961671930 3:128538914-128538936 TGGTTCAAACAGATCGCACAAGG - Intergenic
964774198 3:160257139-160257161 CTGCTCAATCAGATTTCATCTGG + Exonic
969605998 4:8202585-8202607 CTGATCAATCAGATTACAGTTGG + Intronic
970672332 4:18411159-18411181 CTGTTCAATCAAATTCTTCATGG - Intergenic
970808858 4:20067428-20067450 CTCTTCAATCAGAGTGGAGATGG + Intergenic
972047314 4:34682820-34682842 CTGTAAACTCAGTTTGCACATGG - Intergenic
977736090 4:100417852-100417874 CTGTTTAATGTGATTGCATAAGG + Intronic
979648704 4:123105344-123105366 CTGTTCATTGACAATGCACATGG + Intronic
981293004 4:143098219-143098241 CTGTTCTCTGATATTGCACAAGG + Intergenic
982300508 4:153874016-153874038 CTGTTCATTGACAATGCACAAGG + Intergenic
982403510 4:154995339-154995361 CTCTTCAAAAAGATTGCAGAGGG - Intergenic
982923726 4:161308366-161308388 CTGTTATATCAGAGTGCTCAAGG - Intergenic
982944035 4:161595668-161595690 CTGATTAATCAGAATGTACAAGG + Intronic
984279806 4:177656717-177656739 CTGTTCATTGAGAATGCACTTGG + Intergenic
986037368 5:3952967-3952989 CTGTTCCCTCAGACAGCACAGGG + Intergenic
986457004 5:7929404-7929426 CTTTTCAAACAAACTGCACATGG + Intergenic
991324338 5:65414114-65414136 CTATTCATTCAGATTCCTCATGG - Intronic
995550645 5:113277821-113277843 CTGTTCACTCACAATGCAGATGG - Intronic
996576924 5:124985785-124985807 CTGTTCATTCAGATTCCTCTCGG - Intergenic
999721857 5:154404337-154404359 CTTTTAAATCAGATTTCACCTGG - Intronic
1000779440 5:165463091-165463113 CTGTTCAAATATTTTGCACATGG - Intergenic
1003501275 6:6704930-6704952 CTCTGCAATCAGATTCCAGAGGG - Intergenic
1004426684 6:15511561-15511583 ACCTTCCATCAGATTGCACAGGG + Intronic
1005835949 6:29709771-29709793 CTTTTCAATGAGAATGAACAGGG + Intergenic
1014152740 6:118077252-118077274 CTCTGCAAAGAGATTGCACATGG + Intronic
1028910626 7:96203492-96203514 CTGTTCACTCAGCTTTCATAGGG + Intronic
1030615798 7:111736961-111736983 CTGTTTAATCATATTGGAGACGG - Exonic
1031937005 7:127745808-127745830 GTATTCAATCAGACTACACAAGG - Intronic
1032660720 7:133980941-133980963 CTCATCAATCAGCCTGCACAGGG + Intronic
1036129861 8:6099121-6099143 CTGTGGAATCAGTTTCCACAAGG + Intergenic
1036768051 8:11561290-11561312 CTGTTCCCTCAGATTGCTGAAGG + Exonic
1037103722 8:15079760-15079782 CTATTTAATCAGCCTGCACATGG - Intronic
1037138408 8:15491257-15491279 CAGTTCTATCAAATTTCACAGGG - Intronic
1037311516 8:17561449-17561471 CTGTTCAATTATCTTGCACTGGG + Intronic
1038628003 8:29212914-29212936 ATGTATAATCAGATGGCACATGG + Intronic
1041742304 8:61169050-61169072 CTGTTCAATTGGATTGGCCAGGG + Intronic
1043712003 8:83432077-83432099 TAGTTCAATCAAAATGCACATGG - Intergenic
1046956610 8:120068937-120068959 TTGTTAAAGCAGATTGCAAAGGG - Intronic
1047460177 8:125056066-125056088 CTGTTGAATCAGAATAAACATGG + Intronic
1047703006 8:127469263-127469285 CTGCTTAATCTGATTGCTCATGG + Intergenic
1048348738 8:133598565-133598587 GTGTTCAAGCAGCTGGCACAAGG + Intergenic
1049004079 8:139843871-139843893 CTGGTGAATCAGCGTGCACATGG - Intronic
1049738309 8:144221792-144221814 CTGTTCTCTGAGATAGCACAAGG + Intronic
1050824121 9:9922459-9922481 CTCTTCATTCATATTTCACAAGG - Intronic
1052813515 9:33082400-33082422 CTGTACAAACAGAATACACAGGG + Intergenic
1055141662 9:72883317-72883339 CTGTTCATTCAGATTCCTCTTGG - Intergenic
1055734288 9:79311205-79311227 TTGTTAAATCATATTGCACAGGG - Intergenic
1057907360 9:98993201-98993223 CTGTCCAAGCATTTTGCACAGGG - Intronic
1058304722 9:103424941-103424963 CTCTTCAATCAGATTACAGAAGG - Intergenic
1061793318 9:133070147-133070169 TTCTTCAATTAGATTGGACAAGG - Intronic
1061795925 9:133085944-133085966 TTCTTCAATTAGATTGGACAAGG - Intronic
1192436585 X:71147177-71147199 CTGTTCAAGCAGCATGCCCAGGG + Intronic
1194330240 X:92574200-92574222 CTGTTCTGTCATATTGCAAATGG + Intronic
1199205277 X:145141341-145141363 ATGTTTAATTAGATTGCACAAGG - Intergenic
1199415809 X:147582016-147582038 CTCTTCCATAAGATTGAACATGG - Intergenic
1200638949 Y:5693379-5693401 CTGTTCTGTCATATTGCAAATGG + Intronic