ID: 1071961378

View in Genome Browser
Species Human (GRCh38)
Location 10:90811403-90811425
Sequence CAGGTGGATCAGAGAGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 2, 1: 1, 2: 4, 3: 31, 4: 400}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071961378 Original CRISPR CAGGTGGATCAGAGAGATGA AGG (reversed) Intronic
901180593 1:7338978-7339000 CAGGAGGATGAGAGAGAACAGGG + Intronic
901264406 1:7899071-7899093 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
902789403 1:18756416-18756438 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
903183791 1:21618492-21618514 CAGGGGACTCAGCGAGATGAGGG - Intronic
904024228 1:27492073-27492095 TACATTGATCAGAGAGATGAGGG - Intergenic
904817094 1:33212128-33212150 CAGGAGGAACAGAGAGAAGGCGG - Intergenic
906789516 1:48646267-48646289 AAGGAGGCTCAGAGTGATGACGG + Intronic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
907946886 1:59143747-59143769 CAGGGTGATGAGAGATATGATGG + Intergenic
907980330 1:59474063-59474085 CAGTTGGAACAGAGTGATGCAGG - Intronic
908000460 1:59673622-59673644 GAAATGGATGAGAGAGATGAAGG - Intronic
908131087 1:61076345-61076367 AAGGTGAGTCAGTGAGATGAAGG + Intronic
908720129 1:67116680-67116702 CATGTGGAGCTGAGAGGTGAAGG - Intronic
909106873 1:71422263-71422285 CAGCTGCATCAAAGAGATGGGGG - Intronic
909257886 1:73448012-73448034 CTAGTGGAGCAGTGAGATGAAGG - Intergenic
910434260 1:87189403-87189425 TTGGTGGATCAGAGAGACAAGGG - Intergenic
911090961 1:94016484-94016506 CAGCTGGAGCAGGGAGAGGACGG + Intronic
911406355 1:97445283-97445305 AAGGTGAAGCAGAGACATGAAGG - Intronic
912658923 1:111511638-111511660 GAGATAGATCACAGAGATGAGGG - Intronic
912947379 1:114096287-114096309 CTGGGGGAGCTGAGAGATGAGGG + Intronic
915115318 1:153594915-153594937 CTGATGGACCAGAGAGAGGAAGG - Intergenic
915950015 1:160183467-160183489 CAGGGGAATCAGAGAAAAGAGGG - Intronic
916431765 1:164736695-164736717 CAGATGGAGGAGAGAGATGTAGG + Intronic
917478144 1:175386389-175386411 CTGGTGAGTCAGAGAGAGGATGG + Intronic
920561342 1:206940940-206940962 CAGCTGAAACAGAGAGATGGGGG - Intronic
920872863 1:209808401-209808423 CAGGTGTATGAGAGGGATGAGGG + Intergenic
921392474 1:214630496-214630518 CAGGTGCATCAGCCTGATGATGG - Intronic
921447310 1:215261871-215261893 CAGATGCTTCAGAGTGATGAGGG + Intergenic
921606997 1:217167461-217167483 CAAGGGGATCTGAGAGATGCAGG + Intergenic
923963035 1:239105257-239105279 CAGGTGGATCAGAGAGATACAGG - Intergenic
924556972 1:245126693-245126715 CATTTGAATCAGAGTGATGAGGG - Intronic
1062822847 10:547922-547944 CAGGTGGAAATGAGAGATAAGGG - Intronic
1062867281 10:866350-866372 TGGGTGGATGAGAGAGAAGAGGG - Intronic
1063012902 10:2042750-2042772 TAGGTGGGTTAGAGAGATAAAGG - Intergenic
1064451308 10:15444641-15444663 CAGGGAGATCACAGAGCTGAAGG + Intergenic
1066057978 10:31699247-31699269 CAGGTGGAGCTGGGAGAGGAGGG + Intergenic
1066340159 10:34524592-34524614 CAGGTGGGTCAGTTAGCTGATGG - Intronic
1067191676 10:44075109-44075131 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1067508773 10:46877964-46877986 CAGGTGCAACAGGAAGATGAAGG + Intergenic
1067653476 10:48173886-48173908 CAGGTGCAACAGGAAGATGAAGG - Intronic
1067799600 10:49349923-49349945 GAGGTGGAGCAGAAAGAGGAAGG + Intergenic
1068301745 10:55151998-55152020 TATGTGGATGAAAGAGATGAGGG + Intronic
1070324309 10:75377982-75378004 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1070643221 10:78183827-78183849 CAGGGGTGTCAGAGAGATGTTGG + Intergenic
1070940055 10:80336626-80336648 CAGGTGGCTCTGAGATATGCAGG - Intronic
1070944550 10:80378372-80378394 GAGCAGTATCAGAGAGATGAGGG + Intergenic
1071961378 10:90811403-90811425 CAGGTGGATCAGAGAGATGAAGG - Intronic
1071962317 10:90818918-90818940 CAGGAGGAAGAGAGAGATGGGGG - Intronic
1073526267 10:104185040-104185062 CTGGTGAATGGGAGAGATGATGG - Exonic
1073979747 10:109141421-109141443 CAGGAGGAAGAGAGAGATGGGGG - Intergenic
1074969651 10:118525630-118525652 CAGGAGGAAGAGAGAGAGGAAGG - Intergenic
1075174083 10:120143307-120143329 CAGGTGGGCCAGGGAGATGCAGG + Intergenic
1075467542 10:122662920-122662942 GATGTGGATGAGAAAGATGATGG + Intergenic
1075887483 10:125913928-125913950 CAGATGGATCAGCTAAATGAAGG + Intronic
1076120483 10:127933028-127933050 CAGGAGAGCCAGAGAGATGAGGG - Intronic
1076495870 10:130897594-130897616 CAGGTGGAACAGAGAGCTGAAGG - Intergenic
1077172508 11:1174244-1174266 CTGTTGGGTCACAGAGATGAAGG + Intronic
1078172569 11:8939620-8939642 CAGGTGGAACAAAGATATAATGG + Intergenic
1078481658 11:11681609-11681631 CAGGTGAAAGAGAGAGAAGAAGG + Intergenic
1078543760 11:12231449-12231471 CAGGTGGCTCAGGAAGAGGAGGG - Intronic
1078707411 11:13758543-13758565 CAGCTAGATCAGAGGGAAGATGG - Intergenic
1079114121 11:17629713-17629735 AAGGGGGCTCAGAGAGATTAAGG + Intronic
1079976623 11:27099735-27099757 GAGGAGGATCAGAGAGATCTGGG - Intronic
1080812189 11:35715843-35715865 CAGGAGGAAGAGAGAGAGGAAGG + Intronic
1082007642 11:47428670-47428692 CAGGTTGATGACAGGGATGAAGG - Intergenic
1082749119 11:56998943-56998965 CAGTTGGAGCACAGAGAAGAAGG + Intergenic
1083433956 11:62630151-62630173 CAGGTGGAACAGACAGACGCAGG + Intronic
1083598581 11:63932248-63932270 CAGGGGCCTCGGAGAGATGAGGG + Intergenic
1084500122 11:69530392-69530414 AAGGTGGGTCAGGGAGATGAAGG + Intergenic
1084613022 11:70216050-70216072 CAGCTGGATCAGAGAGATGAAGG + Intergenic
1084785672 11:71440450-71440472 CAGGTGGATGAGATGGATGATGG + Intronic
1084913624 11:72411118-72411140 CACCTGGAGCAAAGAGATGAAGG - Intronic
1085408583 11:76278379-76278401 CAGCTGGGACAGAGAGGTGAAGG - Intergenic
1085919714 11:80938178-80938200 CAGGGGAATCAGTGAGAGGAGGG - Intergenic
1086010047 11:82091296-82091318 CAGGCAGATCACAGAGATGCAGG + Intergenic
1086595053 11:88560664-88560686 CAGGTGGATTAGAGATCTGTTGG - Intronic
1087289087 11:96300056-96300078 CAGGAGGCTCAGAGAGAGTAAGG + Intronic
1088170407 11:106990005-106990027 CTGGAGGATCAAAGAGACGAGGG + Intronic
1088596022 11:111440861-111440883 GAGGTGGGTCATGGAGATGAGGG + Intronic
1089148182 11:116345564-116345586 CAGTAGGATGAGAGAGAAGAGGG - Intergenic
1089859018 11:121572425-121572447 CAGGTGAAACAGGGAGACGACGG - Intronic
1090098499 11:123768619-123768641 CAGGAGGAAGAGAGAGATGGGGG - Intergenic
1090240690 11:125179491-125179513 CAGGGGGAGCATAGAGTTGAAGG + Intronic
1090307120 11:125701054-125701076 CAGATGGATCATGGTGATGAAGG + Intergenic
1090647790 11:128779679-128779701 CTGCTGGCTCAAAGAGATGAGGG + Intronic
1091831183 12:3552254-3552276 CAGGTGGTAAAGAGAGAAGAGGG + Intronic
1091894055 12:4086220-4086242 CAGGTTGATTAAAGAGATGTTGG - Intergenic
1092564362 12:9648611-9648633 AAGTTGGATCAGAGAGAGGTTGG - Intergenic
1092614378 12:10203050-10203072 TAGGAGTCTCAGAGAGATGATGG - Intergenic
1093485203 12:19644670-19644692 CAGCTGAAACAGACAGATGAAGG + Intronic
1094433857 12:30399389-30399411 CTGGTGGATCAGAGATAAAAGGG + Intergenic
1094488560 12:30944366-30944388 GAGGGGGATTAGGGAGATGATGG - Intronic
1095655931 12:44668790-44668812 CATGTGGCTCAGAGACCTGAGGG + Intronic
1096983547 12:55742854-55742876 AAGGAGAATCAGAGAGATAAGGG - Intergenic
1098091721 12:66909343-66909365 CAGGTGGAGCAGAGAGCTTGGGG + Intergenic
1098600813 12:72329927-72329949 TAAGGGAATCAGAGAGATGAGGG + Intronic
1099076276 12:78113271-78113293 CTAGTGGATCTGTGAGATGAAGG - Intronic
1099536851 12:83855892-83855914 CTGGTGGATCTGTGAGAAGAGGG + Intergenic
1099587010 12:84532059-84532081 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
1100661809 12:96707764-96707786 CAGGTGGATGAAACAGATGGAGG + Intronic
1100692720 12:97056113-97056135 CAGGAGGAAGAGAGAGATGGGGG + Intergenic
1102847868 12:116207095-116207117 CAGATGGACCACACAGATGATGG + Intronic
1104497027 12:129250489-129250511 CAGGAGGATCAGAGTTAGGAAGG - Intronic
1104708522 12:130967790-130967812 CAGGCGGATGAGAGCGATGCTGG - Intronic
1104754797 12:131262278-131262300 CAGGTGGATCGGAGACAGGATGG + Intergenic
1104990667 12:132622209-132622231 CAGGTGGCTGTGAGAGGTGATGG - Intronic
1106534044 13:30623290-30623312 AAGGTGGATCAGAAAAATAATGG + Intronic
1106945535 13:34823716-34823738 CAGATGGATTAGAGAGATTGTGG - Intergenic
1107079403 13:36358358-36358380 CAGCTGTGTCAGGGAGATGATGG - Intronic
1110379918 13:74838925-74838947 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1110526267 13:76541778-76541800 GAGGTGGATTAGTGAGAAGAAGG - Intergenic
1111420178 13:88000715-88000737 CATAGGGAGCAGAGAGATGAAGG - Intergenic
1112156473 13:96822827-96822849 CATCTGGATCAGAAAGATGGAGG - Intronic
1112423078 13:99271411-99271433 CAGCTGGAGCAGAGTGATGGGGG + Intronic
1113900204 13:113792628-113792650 CTGGAGGAACAGACAGATGAGGG - Intronic
1114416601 14:22549034-22549056 CAGTTGCAGCAGAGAGATGATGG + Intergenic
1114444039 14:22774320-22774342 CAGGTGGAGCAGAGGTAGGATGG + Intronic
1114832131 14:26157309-26157331 CAGAAGGAGAAGAGAGATGAAGG - Intergenic
1115089731 14:29559354-29559376 CAGGAAGATCATAGAGAGGAGGG + Intergenic
1115662140 14:35507108-35507130 CAGGTCTATCAGACAGAGGAGGG + Intergenic
1117201730 14:53396694-53396716 GTGGTGGCTGAGAGAGATGAAGG + Intergenic
1118327193 14:64789496-64789518 CAAGTGGGTCAGTGAGAGGAAGG + Intronic
1118660633 14:68005920-68005942 CAGGTGGAAGAGAGAGAGGAGGG + Intronic
1118660637 14:68005962-68005984 CAGGAGGAAGAGAGAGAGGAAGG + Intronic
1119162837 14:72467586-72467608 CAGTGGGATCAAAGAGGTGAAGG - Intronic
1120091096 14:80334139-80334161 CTGGTGGATCTGTGAGAAGAAGG - Intronic
1120499061 14:85271349-85271371 CAGAAGGAACAGAGAGATGGTGG + Intergenic
1121640858 14:95484002-95484024 CAGGTGCATCAGAGAGCAGCTGG - Intergenic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1122425190 14:101601679-101601701 CAGAAGGCTCAGAGAGGTGAGGG - Intergenic
1202870653 14_GL000225v1_random:160156-160178 CAGATGGATCAGCTAAATGAAGG - Intergenic
1124110200 15:26778147-26778169 CAGGAGGAAGAGAGAGAGGAGGG + Intronic
1125599570 15:40907798-40907820 CAGGTGGAGGAGAAAGCTGAGGG - Intergenic
1125802896 15:42465994-42466016 TGGGTGGATCTGAGTGATGATGG - Intronic
1126797039 15:52267833-52267855 TAGAAGGATCAGGGAGATGAGGG + Intronic
1126906559 15:53374132-53374154 CATGTGTACCAGAGAGATAAGGG - Intergenic
1128686681 15:69691525-69691547 CATGTGAACCAGAGAGAGGATGG + Intergenic
1131382024 15:91972247-91972269 GAGGTGGATATGGGAGATGAGGG + Intronic
1131532881 15:93208929-93208951 CAGGTGGATCACTGAGGTCAGGG - Intergenic
1134523538 16:14928877-14928899 AAGGGGGATAAGAAAGATGAGGG - Intronic
1134549354 16:15132043-15132065 AAGGGGGATAAGAAAGATGAGGG + Intronic
1134711132 16:16327361-16327383 AAGGGGGATAAGAAAGATGAGGG - Intergenic
1134718982 16:16370662-16370684 AAGGGGGATAAGAAAGATGAGGG - Intergenic
1134948442 16:18341222-18341244 AAGGGGGATAAGAAAGATGAGGG + Intergenic
1134955699 16:18381332-18381354 AAGGGGGATAAGAAAGATGAGGG + Intergenic
1135044046 16:19140183-19140205 CAGGATGATCAGAGAGCTGGGGG - Intronic
1135618484 16:23932696-23932718 CATGTGGACCAGAGGGATGGGGG + Intronic
1135886693 16:26316562-26316584 CATGTGGAGCAGGGAGATAAAGG + Intergenic
1136023099 16:27452429-27452451 CAGGAGAATCTGAGAGATGGAGG + Intergenic
1136186351 16:28590979-28591001 CAGGCTGATCAGACAGACGAGGG + Intronic
1137465718 16:48707123-48707145 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1139436998 16:66942076-66942098 CAGGTGGATCAGGAAGAGGCAGG - Intronic
1140833325 16:78770978-78771000 CATTTGGAGCAGAGACATGAAGG + Intronic
1141006857 16:80360504-80360526 CTGGTGGAAGAGAGACATGAAGG + Intergenic
1141244528 16:82293564-82293586 CAGGGGGATCATAGGGTTGAAGG + Intergenic
1141980720 16:87548261-87548283 CGTGTGGATCAGAGGGAGGAAGG + Intergenic
1143097294 17:4485105-4485127 CAGCTGGACCAGAGAGTGGAAGG + Intronic
1143408809 17:6696347-6696369 AAGGTGGCTCAGGGAGATGCAGG + Intronic
1143877145 17:10000512-10000534 CAGGTTGGTCAGAGAGATCTAGG + Intronic
1143887142 17:10073151-10073173 CATGTGAATCACACAGATGAGGG + Intronic
1146793312 17:35765011-35765033 CAGGTTTGTCAGAGGGATGAGGG - Exonic
1147037041 17:37689345-37689367 CAGGTGGAGGAGAGAGAAAACGG + Intronic
1147953675 17:44120905-44120927 CAGAAGGATCAGAGCCATGAAGG + Intronic
1148190199 17:45672861-45672883 CACTAGGATCATAGAGATGAAGG - Intergenic
1148521048 17:48275273-48275295 CAGGGAGATCAGAGAGAATAAGG - Intronic
1148709374 17:49666339-49666361 CAGGTGGATTAGAGACCTAAAGG + Intronic
1148729524 17:49824015-49824037 CAGGTGAATTAGAGAGTTGCTGG + Intronic
1148806846 17:50268223-50268245 CAGATGGAGCAGAGCCATGAAGG - Intergenic
1149555276 17:57569106-57569128 ACGGTGGATTAGAGAGAGGAGGG + Intronic
1149600242 17:57888823-57888845 CTGGAGGGGCAGAGAGATGATGG - Intronic
1151179163 17:72313247-72313269 CAGGTGGATCAGAGAGTTGCTGG - Intergenic
1151432729 17:74075158-74075180 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1151825050 17:76519380-76519402 GAGGAGGATCAGGGAGATGGGGG - Intergenic
1152011459 17:77721335-77721357 AAGGAGGATCAGCCAGATGAAGG + Intergenic
1152405771 17:80097020-80097042 CAGGTGTGGCAGAGAGATGGGGG - Intronic
1153784600 18:8523401-8523423 CAGGGGGATCAGAGATGTGGAGG + Intergenic
1154262923 18:12853635-12853657 GAGATGGGTCAGAGAGAGGAGGG + Intronic
1155998024 18:32352649-32352671 AAGGTAAATCAGAGAAATGAGGG - Intronic
1156250865 18:35351542-35351564 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1156569205 18:38233500-38233522 CGGGTGGTCCAGAGAGAAGATGG + Intergenic
1158873197 18:61708851-61708873 CAGGTGAACTAGAGGGATGAAGG - Intergenic
1160145075 18:76357042-76357064 CAGGTGACACAGAGAGATGTAGG + Intergenic
1161458408 19:4381556-4381578 CAGGGGGAACAGAGAGAGGCAGG - Intronic
1161471862 19:4461540-4461562 CAGGAGAATCCGAGAGATGGAGG - Intergenic
1162073742 19:8170885-8170907 TAAAAGGATCAGAGAGATGAAGG + Intronic
1163144623 19:15372180-15372202 CAGGTGGGCCAGACAGATGTAGG - Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163776981 19:19224627-19224649 AAAGAGGATCAGAGAGAGGAAGG - Intronic
1164625963 19:29728164-29728186 AAGGTGAATCAGGGACATGAAGG - Intergenic
1164650151 19:29885633-29885655 CAGGTAGGTCACAGAGATGAAGG - Intergenic
1164684804 19:30159590-30159612 CGGGTGGATCAGAGATATCTCGG + Intergenic
1165127651 19:33611758-33611780 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1165476911 19:36035939-36035961 CAGGTGGCGGACAGAGATGATGG + Intronic
1165940998 19:39414777-39414799 GAGGTGGATTAGAGAAATGGAGG + Intronic
1166884754 19:45953444-45953466 CAGGTCGTTCAGAGAGACAATGG + Intronic
1167212137 19:48139884-48139906 CAGGTGGATCGGAGAGATGGTGG - Intronic
1167323910 19:48812588-48812610 CATCTGGATCAGAGGGAGGAGGG - Intergenic
925423082 2:3727248-3727270 CAGCTGAATCAGAGAGAAGGTGG - Intronic
925482468 2:4291593-4291615 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
926387828 2:12354831-12354853 CAGGTGGAGAAGAGAGTTGGAGG - Intergenic
928262713 2:29782253-29782275 GAGGTGGATCAGAGAGAGGTAGG + Intronic
932296108 2:70624610-70624632 CAGGTGGATCAGAGAGATGAAGG - Intronic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
933901762 2:86855224-86855246 GAGGAGGCTCAGAGAGGTGAGGG - Intronic
934473477 2:94576891-94576913 CAGGAGCATCAGAGAGAGGAGGG + Intergenic
934928621 2:98400731-98400753 CAGGAAGATCAGAGAGAGGAAGG + Intergenic
934983693 2:98869136-98869158 CAGGAGGATGAGAGAGCTGGAGG - Intronic
935147439 2:100405465-100405487 AAGGTGGGGCAGAGAGAGGATGG + Intronic
935778786 2:106494039-106494061 GAGGAGGCTCAGAGAGGTGAGGG + Intergenic
936374358 2:111927905-111927927 CAGGTGGGTGAGAGAGATATAGG - Intronic
936813615 2:116432985-116433007 CTGGTGGAGCTGCGAGATGAGGG - Intergenic
937067440 2:119028568-119028590 CAGGTAGATTAGAGAGAGGAAGG - Intergenic
939284014 2:140105417-140105439 GAGCTTGATCAAAGAGATGATGG - Intergenic
939428626 2:142073822-142073844 CAGGAGGAAGAGAGAGAGGAAGG - Intronic
941553893 2:166951387-166951409 CAGGAGAAACAGAGAGATAAAGG + Intronic
941830375 2:169951851-169951873 CAGGTTGATGTGAGAAATGAGGG + Intronic
942140575 2:172973499-172973521 CAGGTGGGGCAGAAAGATGCTGG + Intronic
943045400 2:182854879-182854901 AAGGGAGATCAGAGAGATAAAGG + Intronic
943247880 2:185478387-185478409 CTGGTGGATGAGGGAGATGAGGG + Intergenic
943479530 2:188400474-188400496 GAGGTGGAGAGGAGAGATGATGG + Intronic
944464833 2:199990607-199990629 CAGATGGACCACAGATATGATGG + Intronic
945014162 2:205497634-205497656 TAGGAGGATCAAAGAGAAGAGGG - Intronic
945253313 2:207782845-207782867 CAGGAGGATGAGAGATATGTCGG + Intergenic
945262729 2:207859822-207859844 CAGGTGGATCACTGAGGTCAGGG - Intronic
945433820 2:209795947-209795969 CAGGTGGAGCTGTGAGAAGAGGG + Intronic
945656529 2:212631240-212631262 CAGGTGGAGGAAAGAGAAGATGG + Intergenic
945983975 2:216339897-216339919 CAGGAGGCCCAGAGAGATGGTGG - Intronic
946748475 2:222869337-222869359 CAGGGGAGCCAGAGAGATGAAGG - Intronic
947567544 2:231204225-231204247 CAGGAGGCTCAGAGAGAGTATGG - Intronic
948493076 2:238326442-238326464 AAGGTGGAAGAGAGAGAGGAAGG - Intronic
1169332391 20:4726366-4726388 CAAGTGGTTTACAGAGATGATGG - Exonic
1169547728 20:6667905-6667927 CTGATGGATCTGAGAGGTGAGGG - Intergenic
1169810958 20:9608868-9608890 CAGCTGCATCAGATAGATGAAGG - Intronic
1170449808 20:16470952-16470974 CTGGTGGATCTGAGAATTGAGGG - Intronic
1170647828 20:18212573-18212595 CAGGTGGAACAGAGAGAGAAAGG + Intergenic
1170682808 20:18541586-18541608 AAGGAGGAGGAGAGAGATGAGGG + Intronic
1173532437 20:43780717-43780739 ATGGAGGCTCAGAGAGATGATGG - Intergenic
1173581744 20:44151909-44151931 CAGGTGGAAAAGAGAGAGAAAGG - Intronic
1174508992 20:51036901-51036923 CAGCAAGATCAGAGAGAGGAAGG - Intergenic
1175434204 20:58931184-58931206 GAGGTGGCACAGAGAGAGGAGGG + Intergenic
1175759493 20:61551471-61551493 CAATTGAATGAGAGAGATGAGGG - Intronic
1176047226 20:63099247-63099269 CAGGTGGGTCTGAGGGAGGAAGG - Intergenic
1179202499 21:39238018-39238040 TAGGTGGACAAGAGAGATTAAGG + Intronic
1180153288 21:45963891-45963913 CAGGAGGAAGAGAGAGATGGGGG - Intergenic
1181008635 22:20027129-20027151 CAGGAGGAAGAGAGAGATGGGGG + Intronic
1181166515 22:20986561-20986583 TAGGTAGATTAGATAGATGATGG + Intronic
1181462736 22:23095006-23095028 CAGGTGCATGAGGGAGAGGAGGG - Intronic
1182042821 22:27251480-27251502 CTTGTGGAACAGAGAGATGAGGG - Intergenic
1182069627 22:27454517-27454539 CAGGTGATACAGAGAGTTGATGG + Intergenic
1182096755 22:27630848-27630870 CAGGTGGCTTAGAGGGATGAAGG - Intergenic
1182974161 22:34606904-34606926 CAGGGAGACTAGAGAGATGATGG - Intergenic
1183504222 22:38200186-38200208 CTGGAGGCTCAGAGAGGTGAAGG - Intronic
1183692449 22:39398383-39398405 GAGTTGGAGGAGAGAGATGAAGG - Intergenic
1185170859 22:49293213-49293235 CAGCTGGATCAAGGAGATGCTGG + Intergenic
1185199688 22:49494092-49494114 CAGTTGGAGCAGAGAGCAGAGGG + Intronic
949685226 3:6562034-6562056 GAGGTTGGTCAGAGAGATGCTGG - Intergenic
949889408 3:8722393-8722415 CAGGAGGAAGAGAGAGAAGAAGG - Intronic
949918923 3:8986247-8986269 CTGGGGGCTCAGAGGGATGAGGG - Intronic
951252878 3:20415036-20415058 CATGGGGATCAGAGAGACAAAGG - Intergenic
951330042 3:21355986-21356008 AAGGTATATCAGAGAGAAGATGG + Intergenic
952356021 3:32584836-32584858 CAGCTGGAGCAGTGAGAGGAGGG - Intergenic
952590255 3:34944314-34944336 CAGATGGGACAGAGAGAGGAAGG - Intergenic
953794025 3:45969341-45969363 CCTGTGGATGAGAGAGCTGAAGG + Intronic
954285667 3:49617381-49617403 CAGGAAGGGCAGAGAGATGAAGG - Intronic
954462933 3:50638025-50638047 CAGGTGGATTAGAGTCATAAGGG + Intronic
954655455 3:52191522-52191544 CATGTGGATCAGGCAGATCAGGG - Intergenic
954941406 3:54376279-54376301 CAGGTGACTGAGAGAGGTGACGG - Intronic
956696674 3:71924401-71924423 CAGGTGGTTAAGAGAGATGTTGG - Intergenic
958630099 3:96673224-96673246 GAGGTGGAGGAGAGAGATGGAGG - Intergenic
960122208 3:113958419-113958441 CAGCTGGATCAGGAAGATGTAGG - Exonic
960155840 3:114296344-114296366 CAGGTGGATAACAAATATGAGGG - Intronic
961478557 3:127164393-127164415 CAGGTGGATAAGGGAGCTGAAGG - Intergenic
962200720 3:133399310-133399332 CTGGTGCATCAGAGAGTTAAAGG + Intergenic
964256988 3:154786618-154786640 CAGGTGAATGGGAGAGAGGAAGG + Intergenic
964272581 3:154973987-154974009 CTGGTGTCTCAGAGATATGAGGG + Intergenic
967773945 3:193365355-193365377 CAGGTGGATGATAGTGTTGAGGG - Intronic
967776985 3:193395157-193395179 CTGGTGGATCTGCGAGAAGAAGG - Intergenic
968175959 3:196549622-196549644 CAGGTGGAGCTGTGAGAAGAGGG + Intergenic
968180510 3:196591804-196591826 CAGCTGGATGAGAGAGCTGCTGG + Intergenic
969140595 4:5067862-5067884 CAGGAGGATAAGAGAGAGGGAGG + Intronic
969323984 4:6430362-6430384 CAGGTGGATCAGAGAAGACATGG - Intronic
969328806 4:6461069-6461091 CAGGTGGATCAGGTAGGAGAGGG - Intronic
970594391 4:17586633-17586655 CTGCAGGATCAGAGGGATGAGGG + Intronic
971058652 4:22941873-22941895 CAGGTGGCTCAGTGATGTGAGGG + Intergenic
972344417 4:38180910-38180932 CAGGTGGTTTTGAGACATGAAGG - Intergenic
973220738 4:47723277-47723299 CAGGGAGATCACAGAGAAGAGGG + Intronic
975607610 4:76171146-76171168 CATGTGCATGTGAGAGATGAGGG - Intronic
976000913 4:80372178-80372200 CAGGAGGAAGAGAGAGATGGAGG + Intronic
976532891 4:86175578-86175600 CAGGAGGAAGAGAGAGAGGAGGG - Intronic
978155104 4:105480794-105480816 CATGTGGTTCAGATACATGAGGG + Intergenic
978187417 4:105872766-105872788 CAGGAGGAAGAGAGAGATGGGGG - Intronic
978794670 4:112697296-112697318 CAGGTGAAGAAGAGAGGTGAAGG + Intergenic
979410751 4:120375764-120375786 CTGGTGGAACACAGAGGTGATGG - Intergenic
979881246 4:125962740-125962762 CAGGTGCAAGAGAGAGAGGAGGG - Intergenic
981269543 4:142829015-142829037 TAGGTAGATCAGAGGGAGGAGGG + Intronic
981269567 4:142829335-142829357 CAGGTAGATCAGAGGGAGGAGGG + Intronic
982081368 4:151793452-151793474 ATGGTGGGTCAGAGAGAGGAAGG + Intergenic
982618746 4:157677340-157677362 CAGGAGGAAGAGAGAGATGAGGG + Intergenic
982893261 4:160882953-160882975 CAGGAGGAAGAGAGAGATGGAGG + Intergenic
984412001 4:179407178-179407200 CAGGTGTATCAGAGAGATACAGG - Intergenic
984576229 4:181451621-181451643 CAGCTGGATCAGAAAGAGAATGG + Intergenic
985936727 5:3103150-3103172 CAGATGGATGGGGGAGATGAAGG - Intergenic
986093572 5:4534915-4534937 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
986190330 5:5491153-5491175 CAGGTGGAGCTGGGAGCTGACGG + Intergenic
986335209 5:6749605-6749627 GAGGTGGATCAAAGAGAAGTGGG + Exonic
987490001 5:18568004-18568026 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
989494127 5:42091291-42091313 AAGGTGTATCAAAGAGATGATGG - Intergenic
989662751 5:43816781-43816803 CAGGAGGATGAGAGAGAAGGAGG - Intergenic
989758309 5:44983151-44983173 CAGGAGGATCAGAAAGACCATGG + Intergenic
990238719 5:53795686-53795708 CAGATGGAGCAGGGAGAAGATGG - Intergenic
990257325 5:53984357-53984379 AAGCAGGATAAGAGAGATGAAGG - Intronic
990304337 5:54480120-54480142 CAGGAGGAAGAGAGAGAGGAGGG - Intergenic
990812799 5:59748050-59748072 CAAGTGGATTCAAGAGATGATGG - Intronic
990924028 5:60998652-60998674 CAGGATGATCACAGAGATTAGGG - Intronic
991004161 5:61811577-61811599 AAGGTGGATGGGGGAGATGATGG + Intergenic
991273518 5:64815366-64815388 CAGGAGGAAAAGAGTGATGAAGG + Intronic
991522414 5:67515556-67515578 CAGGAGGAAGAGAGAGATGGCGG - Intergenic
992950261 5:81851310-81851332 GAGGTGGATCAGAGGGAGGAAGG + Intergenic
996876980 5:128250862-128250884 CAGGAGGAAGAGAGAGAGGAGGG - Intergenic
996958787 5:129218454-129218476 CAGGTGTATTAGGTAGATGATGG + Intergenic
997417268 5:133738714-133738736 CAGGTGGGGCTGAGAGATGACGG + Intergenic
997592086 5:135080450-135080472 CAGGAGGAAGAGAGAGATGGGGG + Intronic
997666683 5:135635057-135635079 CATGTGGAACAGAGACATGGGGG - Intergenic
1000784671 5:165528757-165528779 CTAGTGGATCAGTGAGAAGAAGG + Intergenic
1001141344 5:169146552-169146574 CAGGTGGATAACAGAGAAGGGGG - Intronic
1001256764 5:170189375-170189397 CCGGTGGATCTGAGAAAGGAAGG - Intergenic
1001781276 5:174371101-174371123 GAGGTGGAGCAAAGAGATCATGG - Intergenic
1003019292 6:2496138-2496160 CAGGTGGAGAAGGGAGGTGAAGG + Intergenic
1003038526 6:2666215-2666237 TAAGTGGATCTGAGAGATAATGG + Exonic
1003144503 6:3498573-3498595 GAGGTGGCTCAGAGACATGGAGG - Intergenic
1003559684 6:7170399-7170421 CAGGAGCAGCAGAGAGGTGAGGG + Intronic
1004159249 6:13198948-13198970 CAGGTAGATCAGAGTGATCTGGG + Intronic
1004287901 6:14339613-14339635 CAGGTGGGTCAGGGGGAGGAGGG - Intergenic
1004458495 6:15813906-15813928 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1010644268 6:78368189-78368211 CAGGAGGAAAAGAGAGATGGAGG - Intergenic
1010875785 6:81103779-81103801 CAGGAGGAAGAGAGAGATGGTGG - Intergenic
1011460247 6:87595619-87595641 CTGGTGCTTCCGAGAGATGATGG - Intronic
1011594522 6:89003744-89003766 CAGGAGGAAGAGAGAGATGGGGG - Intergenic
1011706123 6:90003208-90003230 GAGGTGAGTCAGAGAGGTGATGG - Intronic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1013201913 6:107906156-107906178 CAGGAGGAAGAGAGAGATGGGGG - Intronic
1014843821 6:126251608-126251630 GAGGTGGATTAGACAGATGTTGG - Intergenic
1015890795 6:137967913-137967935 CTGGAGCATCAGAGTGATGATGG - Intergenic
1016128362 6:140434286-140434308 CTGGTGGATCTGTGAGAAGAGGG + Intergenic
1016840127 6:148517386-148517408 CAGCTGAATAAGATAGATGATGG + Intronic
1018839334 6:167507450-167507472 CAGGGGGGTCAGACAGAGGACGG - Intergenic
1019050597 6:169180127-169180149 CTGGTGGAGCAGTGAGAAGAGGG - Intergenic
1020712257 7:11622692-11622714 CAGGTTGATAAGAGAGAATAAGG - Intronic
1021764235 7:23930782-23930804 GAGGTGGGTTAGGGAGATGATGG + Intergenic
1021807490 7:24371692-24371714 CAGAAGTATCAGAAAGATGATGG - Intergenic
1023173658 7:37414397-37414419 AAGGTGGAGAAGAGAGAGGACGG + Intronic
1023222667 7:37935296-37935318 CAGGTGGGATAGAGAGATGAAGG - Intronic
1023269474 7:38445938-38445960 CAGGAGGAAGAGAGAGAGGAGGG - Intronic
1023406531 7:39839532-39839554 CAGGTGGAAAAGCCAGATGAGGG - Intergenic
1023589391 7:41765118-41765140 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1023606495 7:41936191-41936213 CTAGGGGCTCAGAGAGATGAAGG + Intergenic
1023663445 7:42494165-42494187 CATGTTGCTCAGTGAGATGAAGG + Intergenic
1026280749 7:68919796-68919818 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1027800924 7:82747850-82747872 CTGGAGGATCAGAGACAAGAAGG + Intergenic
1028175674 7:87655568-87655590 GAGAGGGATCAGAGAGATGTTGG + Intronic
1028874226 7:95802405-95802427 CAGTTGAATCAGAGAGAAGTTGG + Intronic
1029667568 7:102005705-102005727 CAGGTGGAGTAGACAGAGGAGGG - Intronic
1029714398 7:102318052-102318074 CAGCTGGATCAGAGGCATGATGG + Intronic
1029788850 7:102821267-102821289 GAGTTGGATCAGAGAGAAGGGGG - Intronic
1030741329 7:113113424-113113446 AAGGTGGATGTGGGAGATGACGG + Intergenic
1031074354 7:117198706-117198728 CAGGTGCAACAGGGAGAGGAAGG - Intronic
1032887628 7:136158642-136158664 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1033018802 7:137700173-137700195 CAGTTGTATCAGTGAGGTGAAGG + Intronic
1033156741 7:138963274-138963296 AAGGTGCAGGAGAGAGATGAAGG + Intronic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034929196 7:155147905-155147927 CAGGGGGAAGAGAGAGAGGAGGG - Intergenic
1035476368 7:159146666-159146688 CAGGTAGATCACAGATATGCCGG - Intergenic
1035570570 8:669980-670002 CAGGTGGAGAGGAGAGAGGACGG - Intronic
1035931702 8:3786792-3786814 CAGGTGGTAGAGAGAGAAGAAGG + Intronic
1036074240 8:5476882-5476904 CAGGTGTGACAGAGAGAAGAAGG + Intergenic
1037522486 8:19693360-19693382 CTGGTAGAACAGAGAGAGGATGG - Intronic
1037742163 8:21616488-21616510 CAGATGGAACAGAGAGCTGCAGG + Intergenic
1037914548 8:22764929-22764951 CCAGTGGGTCAGAGAGAGGAGGG + Intronic
1039116692 8:34099261-34099283 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1039405390 8:37308280-37308302 CATGAGGAAGAGAGAGATGAGGG + Intergenic
1039506515 8:38056469-38056491 CAGGTGGGTGAGTGAGCTGAGGG + Intronic
1039775943 8:40736806-40736828 CGGGTGGAAGAAAGAGATGAGGG + Intronic
1039823511 8:41154389-41154411 CAGATGGAGCAGAGAGAAGGAGG + Intergenic
1040563992 8:48549662-48549684 CAGGGTGATCAGAGACATGGAGG + Intergenic
1040855762 8:51946693-51946715 CAGCTGCATCCCAGAGATGATGG + Intergenic
1040969495 8:53118861-53118883 AAAGTGGATCATAGAAATGAAGG - Intergenic
1041392361 8:57358445-57358467 CAGGAGGAGGAGAGAGAGGAGGG + Intergenic
1041480275 8:58312366-58312388 GATGTGGATCTGAGAGTTGAGGG - Intergenic
1042310507 8:67374700-67374722 CAGGTGGACCAGAGAGAAGGTGG - Intergenic
1042544863 8:69942369-69942391 TTGGTGGAAGAGAGAGATGAGGG + Intergenic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1044381515 8:91539621-91539643 AAGGGGGAAAAGAGAGATGAGGG - Intergenic
1045321169 8:101082347-101082369 CAGGGTGATCAGATAGATAATGG - Intergenic
1048967606 8:139625689-139625711 CAGCTGCAGCAGAGAGATGAAGG - Intronic
1049280451 8:141741460-141741482 CAGCTGGAACATAGAGAGGAAGG - Intergenic
1049513692 8:143042715-143042737 CAGGTAGCCCAGAGAGCTGAGGG + Intronic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1053024962 9:34721743-34721765 CAGGTGAATGATGGAGATGAAGG - Intergenic
1053193739 9:36098037-36098059 CAGGAGGAGGAGAGAGAAGAGGG + Intronic
1053684853 9:40511611-40511633 CAGGAGCATCGGAGAGAGGAGGG - Intergenic
1053934816 9:43139894-43139916 CAGGAGCATCGGAGAGAGGAGGG - Intergenic
1054278874 9:63113345-63113367 CAGGAGCATCGGAGAGAGGAGGG + Intergenic
1054297945 9:63347074-63347096 CAGGAGCATCGGAGAGAGGAAGG - Intergenic
1054395962 9:64651592-64651614 CAGGAGCATCGGAGAGAGGAGGG - Intergenic
1054430606 9:65156787-65156809 CAGGAGCATCGGAGAGAGGAGGG - Intergenic
1054499774 9:65864734-65864756 CAGGAGCATCGGAGAGAGGAGGG + Intergenic
1055735803 9:79328715-79328737 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1056751737 9:89356931-89356953 CTGGTGCACCAGAGAGAGGATGG - Intronic
1057167584 9:92940915-92940937 GAGGTGGAGCAGAGAGCTGGAGG + Intergenic
1057332641 9:94129907-94129929 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1057556939 9:96095502-96095524 GAGGAGGAGGAGAGAGATGATGG - Intergenic
1058299570 9:103355422-103355444 CAGGAGGAGAAGAGAGATAAAGG - Intergenic
1059438709 9:114290807-114290829 CAGGGGGAGCAGGGAGACGATGG + Exonic
1059564389 9:115368838-115368860 CAAATGGAACAAAGAGATGATGG - Intronic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1203733802 Un_GL000216v2:116434-116456 CAGATGGATCAGCTAAATGAAGG + Intergenic
1186990323 X:15060142-15060164 CAGGCTGAGCAGATAGATGAGGG + Intergenic
1187055006 X:15734652-15734674 TAGGTGGATCAGAGTGAGAAAGG + Intronic
1187071349 X:15892014-15892036 CAGGAGGAAAAGAGAGATGGGGG + Intergenic
1187734427 X:22289759-22289781 CAAGTGGATCTGTGAGAAGAAGG + Intergenic
1191998801 X:67126190-67126212 CAGGAGGAAGAGAGAGCTGAGGG - Intergenic
1192733323 X:73823473-73823495 CCTGAGGATAAGAGAGATGAGGG - Intergenic
1193026414 X:76850460-76850482 CAGGAGGAACAGAGAGAGGGGGG + Intergenic
1193186825 X:78523239-78523261 CAGGAGGAAAAGAGTGATGAGGG + Intergenic
1193736839 X:85167234-85167256 CTGGGGAATCAGAGAGATGGGGG + Intergenic
1194756840 X:97747671-97747693 CAGGTTAATCAGGGAGATGGTGG + Intergenic
1194824698 X:98547366-98547388 CAGGTGGGTCACTGAGATGCTGG - Intergenic
1195198463 X:102522066-102522088 TAGATGGGTCAGAGAAATGATGG - Intergenic
1195570876 X:106397435-106397457 CAGGAGCAAAAGAGAGATGAGGG - Intergenic
1195989894 X:110672064-110672086 CAGGAGGAACAGACAGAGGAGGG + Intergenic
1198146699 X:133864504-133864526 CAGGTGGAAAGGAGAGGTGATGG - Intronic
1199185645 X:144911982-144912004 CAGGAAGCTCAGAGAGATCAGGG - Intergenic
1199704766 X:150414311-150414333 CAGGTGGATCACAGAAAAGCAGG + Intronic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1199966374 X:152824148-152824170 CGGGTGGACCAGAGAGATGGAGG - Intergenic
1202627209 Y:56871986-56872008 CAGATGGATCAGCTAAATGAAGG - Intergenic