ID: 1071961788

View in Genome Browser
Species Human (GRCh38)
Location 10:90814340-90814362
Sequence CTGTGGTTATAGGGGCTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071961781_1071961788 1 Left 1071961781 10:90814316-90814338 CCATTACCTAGTTCATGATAAAT 0: 1
1: 0
2: 2
3: 25
4: 186
Right 1071961788 10:90814340-90814362 CTGTGGTTATAGGGGCTAAAGGG No data
1071961780_1071961788 2 Left 1071961780 10:90814315-90814337 CCCATTACCTAGTTCATGATAAA 0: 1
1: 0
2: 5
3: 30
4: 189
Right 1071961788 10:90814340-90814362 CTGTGGTTATAGGGGCTAAAGGG No data
1071961779_1071961788 14 Left 1071961779 10:90814303-90814325 CCACTAAATATGCCCATTACCTA 0: 1
1: 1
2: 7
3: 40
4: 229
Right 1071961788 10:90814340-90814362 CTGTGGTTATAGGGGCTAAAGGG No data
1071961782_1071961788 -5 Left 1071961782 10:90814322-90814344 CCTAGTTCATGATAAATGCTGTG 0: 1
1: 2
2: 13
3: 29
4: 225
Right 1071961788 10:90814340-90814362 CTGTGGTTATAGGGGCTAAAGGG No data
1071961778_1071961788 15 Left 1071961778 10:90814302-90814324 CCCACTAAATATGCCCATTACCT 0: 1
1: 0
2: 8
3: 29
4: 187
Right 1071961788 10:90814340-90814362 CTGTGGTTATAGGGGCTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071961788 Original CRISPR CTGTGGTTATAGGGGCTAAA GGG Intronic
No off target data available for this crispr