ID: 1071962549

View in Genome Browser
Species Human (GRCh38)
Location 10:90821330-90821352
Sequence AGAAAGAGCACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071962539_1071962549 20 Left 1071962539 10:90821287-90821309 CCAGCAGCAGCCCCAAAGCATAG No data
Right 1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG No data
1071962538_1071962549 21 Left 1071962538 10:90821286-90821308 CCCAGCAGCAGCCCCAAAGCATA No data
Right 1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG No data
1071962542_1071962549 8 Left 1071962542 10:90821299-90821321 CCAAAGCATAGAGAATCCGTGCA No data
Right 1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG No data
1071962534_1071962549 28 Left 1071962534 10:90821279-90821301 CCCAACCCCCAGCAGCAGCCCCA No data
Right 1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG No data
1071962537_1071962549 22 Left 1071962537 10:90821285-90821307 CCCCAGCAGCAGCCCCAAAGCAT No data
Right 1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG No data
1071962536_1071962549 23 Left 1071962536 10:90821284-90821306 CCCCCAGCAGCAGCCCCAAAGCA No data
Right 1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG No data
1071962547_1071962549 -8 Left 1071962547 10:90821315-90821337 CCGTGCACTTGGGGGAGAAAGAG No data
Right 1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG No data
1071962535_1071962549 27 Left 1071962535 10:90821280-90821302 CCAACCCCCAGCAGCAGCCCCAA No data
Right 1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG No data
1071962533_1071962549 29 Left 1071962533 10:90821278-90821300 CCCCAACCCCCAGCAGCAGCCCC No data
Right 1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG No data
1071962540_1071962549 10 Left 1071962540 10:90821297-90821319 CCCCAAAGCATAGAGAATCCGTG No data
Right 1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG No data
1071962541_1071962549 9 Left 1071962541 10:90821298-90821320 CCCAAAGCATAGAGAATCCGTGC No data
Right 1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071962549 Original CRISPR AGAAAGAGCACAGTGATTGT GGG Intronic