ID: 1071962571

View in Genome Browser
Species Human (GRCh38)
Location 10:90821500-90821522
Sequence CACCTTAGCCTGCAGTGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 7, 2: 22, 3: 95, 4: 353}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071962571_1071962578 22 Left 1071962571 10:90821500-90821522 CCTTGCCACTGCAGGCTAAGGTG 0: 1
1: 7
2: 22
3: 95
4: 353
Right 1071962578 10:90821545-90821567 GAAAGGCAGTCTAGGTCACAAGG 0: 10
1: 207
2: 411
3: 611
4: 719
1071962571_1071962577 14 Left 1071962571 10:90821500-90821522 CCTTGCCACTGCAGGCTAAGGTG 0: 1
1: 7
2: 22
3: 95
4: 353
Right 1071962577 10:90821537-90821559 ACAAATTAGAAAGGCAGTCTAGG No data
1071962571_1071962576 5 Left 1071962571 10:90821500-90821522 CCTTGCCACTGCAGGCTAAGGTG 0: 1
1: 7
2: 22
3: 95
4: 353
Right 1071962576 10:90821528-90821550 GGGTCTTAAACAAATTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071962571 Original CRISPR CACCTTAGCCTGCAGTGGCA AGG (reversed) Intronic
900277805 1:1843609-1843631 CACCTTAGCCTGGATTCACATGG + Intronic
900796730 1:4712553-4712575 CCCCTTAGTCTGCAGCGTCATGG - Exonic
901236368 1:7669681-7669703 CACCTTTCCCTGCAGTGGGGCGG - Intronic
901249060 1:7759033-7759055 CACCTCAGCCTCCAGTAGCTGGG - Intronic
902120414 1:14160199-14160221 CACTTTAGCCTGCAATAGCAAGG + Intergenic
902946038 1:19839910-19839932 CACCTTAGCCTCGAGTAGCTGGG - Intergenic
903014399 1:20352601-20352623 CACCTCAGCATGCTGTAGCAGGG + Intronic
909054721 1:70807316-70807338 CTTCTGAGCCTGCAGGGGCAGGG + Intergenic
910259775 1:85283926-85283948 CTTCTGAGCCTGCAGGGGCAGGG - Intergenic
910349407 1:86278137-86278159 CACTTTAGCTTACAGTGGCAAGG + Intergenic
910547238 1:88432466-88432488 CAGTTTAGCCTGTAGTGGCCAGG - Intergenic
911177112 1:94827873-94827895 GACCATTCCCTGCAGTGGCAGGG - Intronic
911199286 1:95028319-95028341 CACCTCAGCCTCCAGTAGCTGGG + Intronic
911988134 1:104657589-104657611 CACCTTGGCCCTCAGTGGCAAGG + Intergenic
913416941 1:118619219-118619241 CACTTTAGCCTGCAGGGGTGAGG + Intergenic
915349056 1:155213275-155213297 CAGCTTTGCCTGCAGCAGCAGGG - Exonic
915352243 1:155233902-155233924 CAGCTTTGCCTGCAGCAGCAGGG - Intergenic
915693736 1:157716963-157716985 CACTTTAGCCCACAGTGACAAGG + Intergenic
916666328 1:166971090-166971112 CAACCCAGCCTGCAGTGGGAAGG - Intronic
917306148 1:173627638-173627660 CACTTTAGCCTGTAGTGGTGGGG - Intronic
917387367 1:174491713-174491735 CACTCCATCCTGCAGTGGCAAGG + Intronic
917796197 1:178534481-178534503 GACTTTAGCATGCAGTGCCATGG - Intronic
918270228 1:182891312-182891334 CACTTTGGTCTGCAGTGGCAGGG - Intergenic
918319894 1:183354493-183354515 CACCTTAGCCTGGGGGGTCAAGG - Intronic
918980787 1:191555895-191555917 CACCTTTGCCAGCAGGGGGAGGG + Intergenic
919067691 1:192714064-192714086 CACTTTAGCCCGCAGTGGTGAGG - Intergenic
919102732 1:193113628-193113650 GATCTTAGCCTGCAGCGGCAAGG - Intergenic
919314042 1:195948556-195948578 CCCCTGAGCCTGCAGCGACAGGG + Intergenic
919336523 1:196243706-196243728 CACTTTAGCCCACAGTGACAAGG - Intronic
920549486 1:206846553-206846575 CACTTTAGCCCACAGTGGTAAGG - Intergenic
920816157 1:209334138-209334160 CTACTTAGCCTGCAGAGGTAAGG - Intergenic
921002170 1:211055426-211055448 GACTTTGGCTTGCAGTGGCATGG - Intronic
922172464 1:223167288-223167310 CAGCTTGGAGTGCAGTGGCATGG + Intergenic
922320570 1:224482874-224482896 CACGTTAGCCTGCGGTGACAAGG + Intronic
922377053 1:224979500-224979522 CTCTTTAGTCTGCAGTGGCAAGG - Intronic
923539648 1:234878705-234878727 CTCCTCAGCCAGCAGTTGCATGG + Intergenic
924558474 1:245137610-245137632 CACATTTGCCTGCAGTACCAAGG + Intergenic
924724522 1:246656814-246656836 CACCTTAGCCTCCTGTAGCTGGG - Intronic
1064696891 10:17975799-17975821 CACTTTAGCCTGAGGTGGCAAGG + Intronic
1066745340 10:38601542-38601564 CACCACATCCTGCAGTGGGAGGG + Intergenic
1067404371 10:46007882-46007904 CAACTTAGCCACCAGTGGCCAGG - Intronic
1069160391 10:65084822-65084844 CTTCTGAGCCTGCAGGGGCAGGG + Intergenic
1069798844 10:71070064-71070086 CAGCGCAGCCTGCAGAGGCAGGG + Intergenic
1071962571 10:90821500-90821522 CACCTTAGCCTGCAGTGGCAAGG - Intronic
1072166610 10:92819463-92819485 CACCTGAGCCTGCAATGTCGTGG + Intergenic
1073291214 10:102414189-102414211 CTCCCTGGCCTGCAGGGGCAGGG + Exonic
1073568900 10:104559287-104559309 CACCTAATCCTTCAGTGACATGG + Intergenic
1073823490 10:107292029-107292051 TACTTTAGCCTGCAGTTCCAAGG + Intergenic
1074921279 10:118016482-118016504 CACCTTAGCCTAGAGTGCCGTGG + Intronic
1075390539 10:122087809-122087831 CTCCTTAGCCTGCTGGGGCCTGG - Exonic
1075496290 10:122922337-122922359 CACTTTAGCCTGCAGTGTCCAGG - Intergenic
1076022413 10:127084929-127084951 CACCTTAGCCTGGGTTGGCATGG + Intronic
1077427356 11:2489414-2489436 CACTTTAGCCCGTGGTGGCAAGG - Intronic
1077664681 11:4096987-4097009 TACCTTGGCCTGGCGTGGCAGGG + Intronic
1077835397 11:5922841-5922863 CACTTTGGCCCACAGTGGCAAGG - Intronic
1078244693 11:9563465-9563487 GACATTAGCCTGTGGTGGCAAGG + Intergenic
1078992540 11:16664558-16664580 GACATTAGCCTGCAGTGGTAAGG - Intronic
1079037832 11:17036303-17036325 CACAGTAGCCTTAAGTGGCAAGG - Intergenic
1079359009 11:19754855-19754877 CCCCTTAGCCTACCGTGGTATGG + Intronic
1080096897 11:28418929-28418951 CACTTTAGCCCACAGTGGCAAGG - Intergenic
1081596091 11:44460658-44460680 CACCTAGGCCTGAAGGGGCAGGG + Intergenic
1081926981 11:46838678-46838700 CACCTCAGCCTCTAGTGGCTGGG - Intronic
1083512868 11:63227779-63227801 CACTTTAGCCTGTGATGGCAAGG + Intronic
1085008278 11:73115055-73115077 CAATTTAGCCTGCAGTGGCAAGG + Intronic
1086838310 11:91653379-91653401 CACTCTAGCCTGCAGTAGTAAGG + Intergenic
1086847895 11:91774244-91774266 CACTTCAGCCTGTGGTGGCAAGG + Intergenic
1087178732 11:95120798-95120820 CACTTTAGCCTACAGTGGCGAGG + Intronic
1087691131 11:101321411-101321433 CACTTTAGCCTGTGGTGGCAAGG + Intergenic
1090136456 11:124204252-124204274 CGCTGTAGCCTGCAGTGGTAAGG + Intergenic
1090254219 11:125271963-125271985 GCCCTGTGCCTGCAGTGGCAGGG + Intronic
1090317623 11:125808004-125808026 CACTTTGGCTTGCAGTGACAAGG - Intergenic
1090677007 11:129007852-129007874 CACTTTAGCTTGCAGTGGTGAGG + Intronic
1092009339 12:5096582-5096604 CATCTTGGCCTTCACTGGCATGG + Intergenic
1092122506 12:6054388-6054410 CACCTGAGCCTACAATGACAAGG + Intronic
1092249416 12:6884304-6884326 CACCTTGGCCTGCAGGGCCTGGG - Intronic
1092526920 12:9315110-9315132 CACCTTGGACTGCAGTGGGCGGG + Intergenic
1092540354 12:9416670-9416692 CACCTTGGACTGCAGTGGGCGGG - Intergenic
1092670777 12:10858492-10858514 TACTTTAGCCTACAGTGACAAGG - Intronic
1092776686 12:11949939-11949961 CACCTGGGCCTGCAGGGGAAGGG + Intergenic
1093991000 12:25590413-25590435 CACTTTAGCCTGCAGTGGCAAGG - Intronic
1094512693 12:31105806-31105828 CGCCTTGGACTGCAGTGGCCGGG + Intergenic
1094598586 12:31888144-31888166 ATCCTTAGCTTGCAGTGACAAGG + Intergenic
1095181805 12:39154651-39154673 CACTTTAGCCTGTGGTGGCAAGG + Intergenic
1095573313 12:43706405-43706427 CACTTTGGCCCTCAGTGGCAAGG + Intergenic
1095573717 12:43710616-43710638 CACTTTAGCTCACAGTGGCAAGG + Intergenic
1095625016 12:44304334-44304356 CACTTTAGCCTGCAGTTGGGAGG - Intronic
1097404522 12:59174442-59174464 CAGGTTAGAGTGCAGTGGCATGG + Intergenic
1097426117 12:59446536-59446558 CACTTTAGCCTGCAATGGTGGGG + Intergenic
1097450801 12:59734426-59734448 CTTCTGAGCCTGCAGGGGCAGGG + Intronic
1097530329 12:60792076-60792098 CACCATGGCCTGCTGTGGCGTGG - Intergenic
1097791251 12:63817828-63817850 CACTTTAGCCCTCAGTGGCAAGG - Intergenic
1097899368 12:64857724-64857746 CACTTTGGCCTGCACTGGCGAGG + Intronic
1098009434 12:66034577-66034599 CACCTCAGCCTCAAGTAGCAGGG + Intergenic
1099093300 12:78340327-78340349 CCCCTGTGCCTGCAGTTGCATGG + Intergenic
1099287047 12:80726165-80726187 CCCCTTACCCTGCAGTAGCCTGG - Intergenic
1101226572 12:102693902-102693924 CACTTTAGCCCACAGTGGCAAGG - Intergenic
1102146983 12:110661520-110661542 CATCTTCACCTGCAGTGGCCTGG - Intronic
1104103245 12:125635054-125635076 CACTTTAGCCCACAGTGGTAAGG + Intronic
1104930899 12:132338992-132339014 CACTTTAACCTGCTGTGACAGGG - Intergenic
1106264099 13:28094542-28094564 CACGTTAGAGTACAGTGGCATGG + Intronic
1106350190 13:28922457-28922479 CACTTTAGCCTGCACTGTCAAGG + Intronic
1106576378 13:30979221-30979243 CCCCTAAGCCTGCAGGGACAGGG + Intergenic
1109336762 13:61004099-61004121 CACTTTAGCCTGCAGTTCCAAGG + Intergenic
1109685756 13:65818288-65818310 CACTTTAGTCTACAGTGGCAAGG - Intergenic
1109753735 13:66730760-66730782 CACTTGAGCCTGCAATGTCAAGG - Intronic
1111949401 13:94698847-94698869 CCCCTTGGAGTGCAGTGGCAGGG + Intergenic
1111969370 13:94894984-94895006 CACCTTAGCTAGCAGTGGGCTGG + Intergenic
1114244976 14:20904671-20904693 CACTTTAGCCTGCTTTGGCAAGG - Intergenic
1114250817 14:20958942-20958964 CACTTTAGCCTACTGTGGCAAGG - Intergenic
1114478652 14:23016766-23016788 CACCCTGGAGTGCAGTGGCATGG + Intronic
1114761685 14:25322798-25322820 CAAATTAGCCCACAGTGGCAAGG + Intergenic
1115861106 14:37687344-37687366 CATGTTAGCCTGTGGTGGCAAGG - Intronic
1115948556 14:38694056-38694078 CACTTTTGCTTGCAGTGGCAAGG - Intergenic
1116045632 14:39739868-39739890 CACTTTAGCCCGCAGTGGCAAGG - Intergenic
1116354716 14:43914180-43914202 CACTTTAGCCCACAGTGGCAGGG - Intergenic
1116930842 14:50688980-50689002 CACTATAGCCCTCAGTGGCAAGG + Intergenic
1117161592 14:52995171-52995193 CACATTAGCCTGCTGCGGCAGGG + Intergenic
1117233891 14:53751752-53751774 CACTTTGGCCTGCGGTGGCAAGG - Intergenic
1117606094 14:57430759-57430781 CACCTTAGCCCTTGGTGGCAAGG - Intergenic
1117973198 14:61272396-61272418 CAGGCTAGCATGCAGTGGCACGG + Intronic
1118096824 14:62546549-62546571 CACTTTAGCCTGCAGTGGTAGGG - Intergenic
1118543453 14:66858033-66858055 GACTTTAGCCTGTGGTGGCAAGG - Intronic
1120426091 14:84350461-84350483 CATGTTAGCCCACAGTGGCAAGG - Intergenic
1122587315 14:102817969-102817991 CACCTTATTCTGCACTGGGAAGG + Intronic
1122618877 14:103041783-103041805 CACCTTGGCCTGCAGGGACTCGG - Intronic
1202883736 14_KI270722v1_random:84851-84873 CAACTGAGCCTGCGGGGGCAGGG + Intergenic
1123888260 15:24749000-24749022 CCCCTGAGCCTGCAGGGGTAAGG - Intergenic
1125477101 15:40054846-40054868 CACCACAGCCTGCAGGTGCAAGG - Intergenic
1125778383 15:42239951-42239973 CACCATAGTCTGAAGTGGGAAGG + Intronic
1126183684 15:45810502-45810524 CACTTTAGCCTGCAGTGGTGAGG - Intergenic
1126706772 15:51413659-51413681 CACCTTAGCCTGCAGCGGCGAGG - Intergenic
1127155857 15:56123700-56123722 CACTTTAGCCTGCAGTGGTGAGG + Intronic
1127971626 15:63966562-63966584 CACTTTAGTCTGCAGTGGTGAGG + Intronic
1128790754 15:70431970-70431992 CCCCTGAGCCTGCAGGGACAGGG + Intergenic
1130665419 15:85865223-85865245 CTCCTTAGCCTGCAGTGACCTGG + Intergenic
1131142041 15:89984817-89984839 CACCTAAGCCACCAGTGACAGGG + Intergenic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1131713883 15:95087434-95087456 CACTGTTGCCTGCAGTAGCATGG - Intergenic
1132875762 16:2136193-2136215 CACTTTAGCCTGCAGCGGGGCGG - Intergenic
1134519223 16:14911160-14911182 CACTTTAGCCTGCAGAGGGGCGG + Intronic
1134554702 16:15155066-15155088 CACTTTAGCCTGCAGTGGGGCGG - Intergenic
1134706893 16:16309815-16309837 CACTTTAGCCTGCAGAGGGGCGG + Intergenic
1134960647 16:18402309-18402331 CACTTTAGCCTGCAGAGGGGCGG - Intergenic
1135075439 16:19389409-19389431 CCCCTTAGCCTCCACGGGCAGGG - Intergenic
1136389271 16:29952109-29952131 CACTTTAGCCTGCAGTGGCAAGG + Intronic
1139659556 16:68411474-68411496 CACCCATGCCTGCAGTGGGAGGG - Intronic
1140464337 16:75167711-75167733 CACCTCAGCCTGGAGTAGCTGGG + Intronic
1142304621 16:89278480-89278502 CACCTGAGCCTGCAGAGGTAGGG + Intronic
1143413610 17:6728599-6728621 CACTTCAGCCTGCAGTGGTGAGG - Intergenic
1144011696 17:11154661-11154683 CACCTTAAGCTGCAATGTCAAGG + Intergenic
1149054491 17:52346935-52346957 CACTTTAGCCTACAGTGGTGAGG + Intergenic
1149884570 17:60327734-60327756 TTCCTGAGCCTGCAGGGGCAGGG - Intronic
1151403494 17:73871667-73871689 CACCTGAGCCTGCAGCAGCAAGG + Intergenic
1152550935 17:81029796-81029818 CACCTCAGCCTCTAGTGGCTAGG + Intergenic
1152701711 17:81822899-81822921 CTCCTGATCCTGCAGTGGCCAGG + Exonic
1153088529 18:1317835-1317857 CACTTTAGCATGCATTGGAAGGG - Intergenic
1153996660 18:10448015-10448037 CACGTTGCTCTGCAGTGGCAAGG - Intergenic
1154357625 18:13633732-13633754 CTTCTGAGCCTGCAGGGGCAGGG + Intronic
1155323876 18:24646704-24646726 CACCTTAGGCTGGAGGGGCAGGG + Intergenic
1155421558 18:25662111-25662133 CACCTGAGCCAGCTGTGACATGG - Intergenic
1155597190 18:27501992-27502014 CACTTTAGCCTACACTGGCGAGG - Intergenic
1156026099 18:32656313-32656335 CCCTTTAGCCTGCAGTGACGAGG + Intergenic
1156912468 18:42426672-42426694 CACTTTAGCCTGCAGTTGCAAGG + Intergenic
1157689646 18:49670949-49670971 AACCCTAGCCCCCAGTGGCAGGG + Intergenic
1158949149 18:62475646-62475668 CACATTAGTCTGCAGTGGTGAGG + Intergenic
1159080543 18:63730953-63730975 CACTTCAGCCTGTGGTGGCAAGG - Intergenic
1159092120 18:63861134-63861156 CACTTTAGCCTGCAATGGTGAGG + Intergenic
1159285022 18:66337385-66337407 CACTTTAGCCCACAGTGGCAGGG + Intergenic
1159446216 18:68544703-68544725 CACGTTAGCCTGTGGTGGCATGG - Intergenic
1159896580 18:74002276-74002298 TACTTTAGCCTGCAGTGGTGAGG + Intergenic
1160488770 18:79319364-79319386 CACATTAGCCAGGAGAGGCAGGG - Intronic
1161826687 19:6572277-6572299 CACTCCACCCTGCAGTGGCAAGG + Intergenic
1161915322 19:7224057-7224079 CACCTCAGCCTCCAGTAGCTGGG + Intronic
1162203534 19:9038527-9038549 CACTCTAGCCTGGAGTGCCATGG - Intergenic
1163794539 19:19329560-19329582 CACATTCTCCTGCAGTGGCTGGG - Intronic
1163886240 19:19967144-19967166 AACCTTAGGCTCCAGTGGCGTGG + Intergenic
1163888229 19:19988340-19988362 AACCTTAGGCTCCAGTGGCGTGG - Intergenic
1163949775 19:20572694-20572716 GACCTTAGGCTCCAGTGGCGTGG + Intronic
1165263979 19:34645394-34645416 CAGCTCAGCCTGCAGTGGGAGGG - Intronic
1166757696 19:45203596-45203618 CACTTTGGCCCGCAGTGGCTAGG + Intronic
1168380095 19:55913067-55913089 CAGCATAGCCTGCATTGCCAAGG + Exonic
1202659159 1_KI270708v1_random:52025-52047 CAACTGAGCCTGTGGTGGCAGGG + Intergenic
925269336 2:2591205-2591227 CACTTCAGCCTGCAGTTGCAAGG - Intergenic
926684239 2:15686365-15686387 CACTGTAGCCTGCAGTAACATGG - Intergenic
926695976 2:15770446-15770468 CACCTAAGCCTGCCCTGGCTTGG - Intergenic
927044525 2:19263404-19263426 AAACTCAGCCTGCAGTGTCAGGG - Intergenic
927613650 2:24566882-24566904 CTTCTGAGCCTGCAGGGGCATGG + Intronic
928239769 2:29576403-29576425 CAAGTTAGCCTGCAGTTGGAAGG - Intronic
928834827 2:35530891-35530913 CACATTAGCCTACTGTGGCAAGG + Intergenic
928846243 2:35676684-35676706 CACTTTAGCCTGCAGTGGGAGGG + Intergenic
928965959 2:36975580-36975602 CAGCCTAGAGTGCAGTGGCATGG - Intronic
930013780 2:46957122-46957144 CACCTTAGACACCAGTGCCAGGG - Intronic
930158950 2:48133241-48133263 CTCCTAAGAGTGCAGTGGCATGG - Intergenic
930526960 2:52542497-52542519 CACCTTAGCCCACAGTGGCGAGG - Intergenic
930611916 2:53553855-53553877 CACTTGAGCCTGCAGGGGGAAGG - Intronic
930727247 2:54694404-54694426 CACTTTAGCCTGGGGTGGCAAGG - Intergenic
930878384 2:56245202-56245224 TACTTTAGCCTGCAGTGGTGAGG + Intronic
930971377 2:57398628-57398650 CCCTTTAGCCTGCAGTGGTGGGG + Intergenic
931600950 2:64001978-64002000 CACCTCAGCCCACAGTGGCAAGG + Intronic
931637163 2:64351299-64351321 CACTTTAGTCCACAGTGGCAAGG - Intergenic
932427952 2:71654975-71654997 CACCTTAGCCTCCTGTAGCTGGG - Intronic
932569515 2:72931287-72931309 CACATTGGCCTGTAGTGGGACGG - Intronic
932644736 2:73488433-73488455 CTTCTGAGCCTGCAGGGGCAGGG + Intronic
932732060 2:74228256-74228278 CTGCTCAGCCTGCAGGGGCATGG + Intronic
934307741 2:91840733-91840755 CACCACATCCTGCAGTGGGAGGG + Intergenic
934870527 2:97861139-97861161 CACTTTAGCCTGAGGTGGCAAGG - Intronic
934928887 2:98404211-98404233 CACTTTAGCCCACAGTGGCAGGG - Intergenic
936901435 2:117485620-117485642 CACGTTAGCCTGCAGTGGCAAGG + Intergenic
938584971 2:132681416-132681438 CACCTAAGCCTGCCATGGCCCGG - Intronic
939483533 2:142779340-142779362 CACTTTAGCCCACAGTAGCAAGG + Intergenic
941672666 2:168311259-168311281 CACTTTGGCCTGCGGTGGCAAGG + Intergenic
942862699 2:180635550-180635572 CACTTTAGCCTGCAGTGGCAAGG - Intergenic
943117588 2:183692271-183692293 CACTTTAGCCCACGGTGGCAAGG + Intergenic
943485521 2:188474368-188474390 CACTTTAGCCCACAGTGGCAAGG + Intronic
944096029 2:195968755-195968777 CACTTTAGCCCACAGTGGCACGG + Intronic
944990618 2:205230764-205230786 CGCTTTAGCCTGCAGTGCCAAGG + Intronic
947312439 2:228818822-228818844 CACTTTAGCCTGAGGTGGCAAGG + Intergenic
948475596 2:238216962-238216984 CACTTCAGCCCGCAGTGGCAAGG + Intergenic
948809213 2:240466363-240466385 CACCTCAGCCTGGAGAGGCCTGG + Exonic
1169200268 20:3705920-3705942 CAGGTCAGACTGCAGTGGCAAGG - Exonic
1169597201 20:7214041-7214063 CACTTTAGCCTGCAGGGGGTGGG - Intergenic
1169618056 20:7471963-7471985 CACTTTAGTCTGTAGTGGCAAGG + Intergenic
1170864198 20:20138354-20138376 CACTTTTGCCTGTGGTGGCACGG + Intronic
1171937903 20:31293443-31293465 CACTTTAGCCCTCAGTGGCAAGG - Intergenic
1172180566 20:33001010-33001032 CCCCTCAGCCTGCAGTGTCCTGG - Intronic
1172847650 20:37939376-37939398 CACCTTAGGCTGGAGTGCCCTGG - Intronic
1173004278 20:39127545-39127567 CACTTTAGCCTGCAGTGGCGAGG + Intergenic
1173098835 20:40064868-40064890 CACCTTAGCCTGCAGTGGTGAGG - Intergenic
1173709677 20:45143632-45143654 CACTTTAGCCTGCAGTGGCGAGG + Intergenic
1174938438 20:54897868-54897890 CACTTTAGCCCACAGTGGCAAGG - Intergenic
1176007980 20:62876543-62876565 GACCTCAGCCCTCAGTGGCAGGG - Intergenic
1176071147 20:63226969-63226991 CATCCTGGCCTGCTGTGGCATGG - Intergenic
1176147702 20:63572784-63572806 CACCTTTGCCCGCAGTCGCGAGG - Intronic
1176896275 21:14382885-14382907 TACCTTGGCCTGCAGGGGCCGGG + Intronic
1177849752 21:26332636-26332658 CACTTTAGCCCACAGTGGCAAGG - Intergenic
1178041341 21:28643562-28643584 CACCTAAGCCTCCAGTAGCTGGG - Intergenic
1178103030 21:29290864-29290886 CACCTGAAGCTGCAGAGGCAGGG + Intronic
1179407275 21:41136444-41136466 CTTCTGAGCCTGCAGGGGCAGGG - Intergenic
1179480218 21:41672222-41672244 CACCTTAGCCACCTGTGGCCTGG + Intergenic
1180326621 22:11435550-11435572 CAACTGAGCCTGCGGGGGCAGGG + Intergenic
1180378240 22:12114310-12114332 CAACTGAGCCTGCGGGGGCAGGG + Intergenic
1181405754 22:22684117-22684139 CACCTCAGCCTGCAGAGGTGGGG - Intergenic
1184118085 22:42433505-42433527 CACCTGAGCAGGCAGTAGCAGGG - Intergenic
1184797228 22:46739235-46739257 CACCTCTGCCTGCAGCAGCAGGG - Intergenic
949448627 3:4162443-4162465 CCCTTTACCCAGCAGTGGCAAGG + Intronic
950106309 3:10391307-10391329 CCACTTAGCCTCCAGGGGCAAGG + Intronic
950523131 3:13508066-13508088 CAGCTTAGCCAGCACTGGCTGGG + Intergenic
950783944 3:15417118-15417140 CAGGCTAGCTTGCAGTGGCATGG - Intronic
952873403 3:37921834-37921856 CATCTTATTCTGCAGAGGCAAGG - Intronic
952912820 3:38204948-38204970 CACTTTAGCCTGCAGAGGCACGG + Intronic
954089028 3:48270328-48270350 CACCTTGGCCTTCAATGACAGGG + Exonic
954173984 3:48828604-48828626 CACCTCAGCCTGGAGTAGCTGGG - Intronic
954420020 3:50413800-50413822 CAAGTTAGAATGCAGTGGCACGG - Intronic
954634089 3:52062277-52062299 CACCTCAGCCTGCAGGGTCTAGG + Intergenic
954693207 3:52406821-52406843 GCCCTTACCCTGCAGTGGCGAGG + Exonic
955001751 3:54933800-54933822 CACTCTAGCCTGCAGTGGCCTGG - Intronic
956636356 3:71369274-71369296 TGCCTCAGCCTGCAGAGGCAAGG - Intronic
957614452 3:82509258-82509280 TTCCTGAGCCTGCAGAGGCAGGG - Intergenic
957907688 3:86578777-86578799 CACTTCAGCCTGTAGTGGTAAGG + Intergenic
957976204 3:87448017-87448039 CACTTTAGCCTGCAGTGATGGGG + Intergenic
958481984 3:94654455-94654477 AACCTTAGGCCCCAGTGGCATGG + Intergenic
958675668 3:97265577-97265599 CTCCCGAGCCTGCAGGGGCAGGG + Intronic
958765421 3:98361339-98361361 CACTTTAGCCTGTGGTGGCAAGG + Intergenic
959126037 3:102291156-102291178 CACTTTAGCCTGTGGTGGCAAGG + Intronic
961311299 3:126003789-126003811 CTTCTGAGCCTGCAGGGGCAGGG - Intergenic
962771682 3:138616423-138616445 CAGGTTAGAGTGCAGTGGCATGG + Intronic
962870946 3:139492319-139492341 CACTTTAGCCTACAGTGGTGGGG + Intergenic
964858261 3:161170971-161170993 CTCCTTCTCCTTCAGTGGCATGG - Intronic
965047374 3:163597108-163597130 CACTGTAGCCTGTGGTGGCAAGG - Intergenic
965380538 3:167982793-167982815 TACTTTAGTCTGCAGTGGCAAGG - Intergenic
966849259 3:184154903-184154925 AACCTTAGCGTCCAGTTGCAAGG - Intronic
967938101 3:194745521-194745543 GACCACAGCCTGCAGTGGGAGGG - Intergenic
968017931 3:195356346-195356368 CACTTTAGCCTGTGGTGGCGAGG - Intronic
968438598 4:609798-609820 CACCTGAGCCTGAAGGGGCAGGG - Intergenic
968488333 4:876016-876038 CACCTGAGCCTGCAGAGGGCAGG + Intronic
968730645 4:2267810-2267832 CGCCTCAGCCTGCAGTGGGCAGG + Intergenic
968838420 4:2982076-2982098 CTTCTGAGCCTGCAGGGGCAGGG + Intronic
970071296 4:12162586-12162608 CACTCTAGCTTTCAGTGGCAAGG + Intergenic
971567927 4:28168664-28168686 CACTTTAGCCTTCAGTGGCAGGG + Intergenic
972272304 4:37523111-37523133 CACTTTGGCCCTCAGTGGCAAGG + Intronic
972645746 4:40966550-40966572 CTTCTGAGCCTGCAGGGGCAGGG - Intronic
972856436 4:43113486-43113508 CACTGTAGCCCTCAGTGGCAAGG - Intergenic
973214533 4:47654682-47654704 CACTTTAGCCTGTGGTGGTAAGG - Intronic
973852685 4:54976935-54976957 CACTTCAGCCTGCAGTAGCGAGG - Intergenic
974597316 4:64030684-64030706 CACTTTAGACTGTGGTGGCAAGG + Intergenic
974941631 4:68476347-68476369 CAGGCTAGCCTGCAGTGGGATGG + Exonic
976413894 4:84749003-84749025 CACCTTAGCCTCCAGTAGGTAGG + Intronic
976525537 4:86083552-86083574 CAGTTTAGCCTGCAGTGGTAAGG - Intronic
976725290 4:88210301-88210323 CACCTCAGCCTCCAGTGGCTGGG + Intronic
977341473 4:95763933-95763955 CACCTTAGCCCATAGTGGCAAGG - Intergenic
977527919 4:98166718-98166740 CACTTTTGCCAACAGTGGCAGGG + Intergenic
977854717 4:101875767-101875789 CACTTTAGCCAGTAGTGGAAAGG - Intronic
978261642 4:106767684-106767706 AACTTTAGCTCGCAGTGGCAAGG - Intergenic
979327350 4:119395297-119395319 CACCTTAGACTGCAGTTCCAGGG + Intergenic
980172490 4:129306364-129306386 CACTTTAGCCTGTGGTGGCAAGG + Intergenic
980172497 4:129306406-129306428 CACTTTAGCCTGTGGTGGCAAGG + Intergenic
980172504 4:129306448-129306470 CACTTTAGCGTGTGGTGGCAAGG + Intergenic
980712660 4:136590840-136590862 CACTTTAGCCCACAGTGGCAAGG - Intergenic
981140144 4:141258848-141258870 CACTTTAGTCTGTGGTGGCAGGG - Intergenic
981394614 4:144233426-144233448 CACATTAGCCCACAGTGGTAGGG - Intergenic
981895565 4:149795455-149795477 CACTTTAGCCTGCAGTGGTGAGG - Intergenic
982339746 4:154284760-154284782 CTCTTTAGCCTGCAGTGGCAAGG - Intronic
982362827 4:154540412-154540434 CACCTTAGTCTTCAGTTGTATGG - Intronic
982373708 4:154663097-154663119 CACCTGGGCCTGTTGTGGCATGG + Intronic
982911475 4:161148228-161148250 CACTTTAGCCTGCGGTGGCAGGG - Intergenic
983245233 4:165279985-165280007 CACCTTAGACTGCAGTTCCAGGG + Intronic
984915499 4:184719516-184719538 CACTTTAGCCCATAGTGGCAAGG - Intronic
987163886 5:15173883-15173905 CACTTTATCCTGCAGTGGTGAGG - Intergenic
987537633 5:19208673-19208695 CTTCTGAGCATGCAGTGGCAGGG - Intergenic
988608618 5:32703988-32704010 CACTTTAGCCCACTGTGGCAAGG + Intronic
988644044 5:33074050-33074072 CTCCTTAGTCTGCAGAGGGAAGG - Intergenic
989130830 5:38105185-38105207 CTCCATAGCATGCACTGGCAAGG - Intergenic
989329993 5:40245812-40245834 CACTTTAGCCTGTGGTGGCATGG - Intergenic
990899860 5:60738723-60738745 CACTTTAACCTGCAGTGGCGAGG - Intergenic
991297094 5:65093109-65093131 CACTGCAGCCTACAGTGGCAGGG - Intergenic
991685869 5:69182048-69182070 CACCTGTGCCAGCAGGGGCATGG - Intergenic
991699097 5:69300620-69300642 CACTCTACCCTGCAGTGACAGGG - Intronic
993256998 5:85604625-85604647 CACTTTAGCTCACAGTGGCAAGG - Intergenic
994092309 5:95820235-95820257 CACCTCAGCCTCCCGTGGCTGGG - Intronic
994226077 5:97253341-97253363 CACTTTAGCCCACAGTGGCAAGG - Intergenic
994614653 5:102089319-102089341 CAACTTAGCCCACAGTGACATGG + Intergenic
995049599 5:107687670-107687692 CACTTTAGCCTGTAGTGGCGGGG - Intergenic
995265208 5:110152015-110152037 CATGCCAGCCTGCAGTGGCAAGG - Intergenic
995268718 5:110195558-110195580 CATTTTAGCTTGCAGTGGAAAGG + Intergenic
995557455 5:113344299-113344321 CACTTTAGCCCACGGTGGCAAGG - Intronic
995847271 5:116507820-116507842 CTCCTTAGCCTGAAGTGAAATGG + Intronic
996176669 5:120368200-120368222 CTTCTGAGCCTGCAGGGGCAGGG - Intergenic
996398161 5:123033780-123033802 CACATTAGCATGTAGTGGCCAGG - Intronic
996494082 5:124133083-124133105 CTGATTAGCCTGCAGTGGCAGGG + Intergenic
996925085 5:128815422-128815444 CACCTGAGTCTGCAAAGGCAAGG - Intronic
996931723 5:128896788-128896810 CACTCTAGCCTGCAGTGGTGAGG + Intronic
997002951 5:129784247-129784269 CACTTTACCCTGTGGTGGCAAGG - Intergenic
998058059 5:139096302-139096324 CACTTTAGCCTGTGGCGGCAAGG - Intronic
998091067 5:139369922-139369944 CACCTCAGACTTCAGTGTCAGGG + Intronic
999220274 5:149970464-149970486 CAGGTTAGAGTGCAGTGGCATGG - Intronic
1001413191 5:171525135-171525157 CCCCTAAGCCTGGAGGGGCAGGG + Intergenic
1004076503 6:12348661-12348683 CAACTCAGCCTGAGGTGGCAGGG - Intergenic
1006463077 6:34175156-34175178 CACTTTAGCCTGTGGTGGCAAGG + Intergenic
1006497846 6:34436913-34436935 TGCCTTAGCCAGCAGTTGCAAGG - Intergenic
1007021766 6:38528289-38528311 CACTTTAGCATGTGGTGGCAGGG - Intronic
1008628119 6:53337402-53337424 CACCTTTTCCTGTTGTGGCATGG - Intronic
1009044270 6:58218734-58218756 GACCTGAGGCAGCAGTGGCAGGG + Intergenic
1009220096 6:60972999-60973021 GACCTGAGGCAGCAGTGGCAGGG + Intergenic
1009684194 6:66935794-66935816 CTTCTAAGCCTGCAGTGTCAGGG - Intergenic
1009748229 6:67847866-67847888 CACGTTGGCCTGTGGTGGCAAGG - Intergenic
1010560394 6:77341664-77341686 CACTTTGGCGTGCAGTGGCAAGG + Intergenic
1010685242 6:78846800-78846822 CACTTCAGCCTGCAGTTGCTTGG - Intergenic
1010838719 6:80622781-80622803 CCCTTTGGCCTGTAGTGGCAAGG - Intergenic
1010864230 6:80953359-80953381 CACTTTGCCCTGAAGTGGCACGG - Intergenic
1011640002 6:89409837-89409859 CACCTGGGCCTGCAGTGGATAGG - Intronic
1011707011 6:90011563-90011585 CACTTTGGAGTGCAGTGGCATGG + Intronic
1011769618 6:90661134-90661156 CTCCTCTGGCTGCAGTGGCAGGG + Intergenic
1012059747 6:94463250-94463272 TGCTTTGGCCTGCAGTGGCATGG + Intergenic
1012190691 6:96276549-96276571 CACTTTAGCCTGCAGTGGTAGGG - Intergenic
1012486356 6:99725838-99725860 CACTTTAGCCTGTGGTGGCAAGG + Intergenic
1012715222 6:102660551-102660573 CCCCTTAGCCTGTGGTGGCGAGG - Intergenic
1013908473 6:115246107-115246129 CACTTTAGCCTGAGGTGGCAGGG - Intergenic
1014794624 6:125710478-125710500 CACTTTAGCCTGCAGTGGTGAGG - Intergenic
1015907199 6:138129449-138129471 CACATTAGCCTGTGGTGACAAGG - Intergenic
1016054819 6:139567346-139567368 CACTTTAGCCTGCAGTGAGTGGG + Intergenic
1016153892 6:140780321-140780343 CACTTTAGCCTGCAGTGGCGAGG - Intergenic
1016282016 6:142429269-142429291 AACCTCAGCCTCCAGTGGCAAGG - Intronic
1017044711 6:150336578-150336600 CACATTAGCCTGCAGTCTTATGG - Intergenic
1017318655 6:153062498-153062520 TACTTTAGCCCACAGTGGCAAGG - Intronic
1017491581 6:154950267-154950289 CACTTGAGCCTGCAGTGGCAGGG + Intronic
1017522488 6:155214147-155214169 CACCCAATCCTGAAGTGGCAGGG - Intronic
1017905866 6:158757197-158757219 CACCTGATACTGCAGAGGCAAGG - Exonic
1018163876 6:161075608-161075630 CCCTTTATCCTGTAGTGGCAGGG + Intronic
1019929514 7:4214555-4214577 CCCCTCAGCCTGCAGAGCCAAGG - Intronic
1020572927 7:9889605-9889627 CACTTTTGCCCACAGTGGCAAGG - Intergenic
1021214711 7:17901440-17901462 CACATTAGCCAGCAGTGGCAAGG + Intronic
1021561468 7:21972314-21972336 CCCCTGAGCCTGCAGGGACAGGG + Intergenic
1022223680 7:28340767-28340789 CACTTTAGCCTGCAGTGGTGAGG + Intronic
1022530543 7:31064212-31064234 CTCCTTAGCCTGCAGCTGCCGGG + Intronic
1022594883 7:31703920-31703942 CAGCTTAGCCTACAGTTGCCAGG + Intronic
1022898476 7:34777209-34777231 CACTTTAGCTTGCAGTGGTAAGG + Intronic
1023277027 7:38530903-38530925 CTCCTTAGCATGCATTGTCATGG + Intronic
1023716158 7:43046474-43046496 CACTTTAGCCTGTGGTGGCGAGG - Intergenic
1024013686 7:45292521-45292543 CACCCTCGCCTGCAGAGCCATGG - Intergenic
1024705933 7:51959610-51959632 CACTTTACCCTGCAGTGGTGAGG + Intergenic
1027604782 7:80287473-80287495 CACTTTAGCCCACAGTGGCAAGG - Intergenic
1028402026 7:90434262-90434284 CTTCTGAGCCTGCAGAGGCAGGG + Intronic
1028527493 7:91801729-91801751 ACCCTGAGCCTGCAGGGGCACGG + Intronic
1028816935 7:95157214-95157236 CTTCTGAGCCTGCAGGGGCAGGG + Intronic
1029042590 7:97593221-97593243 CACTTTGGCCTGTGGTGGCAAGG + Intergenic
1029776976 7:102689614-102689636 CACCTTAGCCAACAGGAGCAGGG + Intergenic
1031553483 7:123143363-123143385 CACTTTAGCCCGCAGTGGTGAGG + Intronic
1034126307 7:148674986-148675008 CACTTTTGCCTGCAGTGGTGGGG - Intergenic
1034448333 7:151124660-151124682 CCCCTGAGCCTGGCGTGGCAAGG + Intronic
1035084639 7:156247560-156247582 CACTTTAGCTTGCAGAGGCAAGG + Intergenic
1036505759 8:9353947-9353969 CACCTGAGCCTGCAAGGTCAAGG + Intergenic
1036531947 8:9598654-9598676 CAGGCTAGACTGCAGTGGCATGG - Intronic
1037295539 8:17396592-17396614 CACTTTAGCCTGCAGTAGTGAGG - Intronic
1038566849 8:28626774-28626796 CACCTCAGTCTTCAGAGGCAAGG - Intronic
1039925094 8:41922729-41922751 CACAATAGCCAGCATTGGCAGGG + Intergenic
1039950603 8:42169184-42169206 TTCCTTAGCCTTCAGTGCCATGG + Exonic
1040628053 8:49175109-49175131 CACTTTATCCTACACTGGCAAGG - Intergenic
1042687953 8:71462429-71462451 CCCCTGAGCCTGCAGGGGAATGG + Intronic
1043997914 8:86842562-86842584 TACTTTAGCTTGAAGTGGCAAGG - Intergenic
1044113239 8:88302889-88302911 CAGCCTAGCCAGGAGTGGCATGG + Intronic
1045172634 8:99687469-99687491 CACTTTAGCCTGCAGTGGCAAGG + Intronic
1045528985 8:102966333-102966355 CACCTGAGCCTGCAAAGTCAAGG - Intronic
1046557212 8:115790104-115790126 CATTTTAGCCCACAGTGGCAAGG - Intronic
1046811514 8:118538389-118538411 CCCTTTAGCTTACAGTGGCAGGG + Intronic
1048706299 8:137156840-137156862 GACTTTAGCCTGTGGTGGCAAGG + Intergenic
1050508120 9:6368575-6368597 TACTTTAGCCTGTGGTGGCAAGG - Intergenic
1051306635 9:15717348-15717370 CACTTTAGTCCACAGTGGCAAGG - Intronic
1051966731 9:22836787-22836809 CACTTTAGCCTGTGGTGGCAAGG + Intergenic
1052093897 9:24361876-24361898 CACTGTAGCCCACAGTGGCAAGG - Intergenic
1054739253 9:68788169-68788191 CCCCTTAGCCTGCAGTGCTGTGG - Intronic
1055244025 9:74218674-74218696 CACCTTAGCCTACAGTGGTGAGG + Intergenic
1058200227 9:102029065-102029087 GACCCAAGGCTGCAGTGGCATGG + Intergenic
1058789669 9:108430121-108430143 CACCTCAGCCTCCAGTAGCTTGG - Intergenic
1060896301 9:127219782-127219804 CTCCTTTGCCTGCACTGCCAGGG + Exonic
1060902850 9:127276234-127276256 CACCTTAGCCTCCCAAGGCAAGG + Intronic
1061231631 9:129319077-129319099 CAGCTTCGAATGCAGTGGCAGGG + Intergenic
1062168539 9:135121506-135121528 CACTTTAGTCAGCACTGGCATGG + Intergenic
1062342569 9:136100300-136100322 CAGCTTAGCCCCCAGTCGCAAGG - Intergenic
1203691647 Un_GL000214v1:47992-48014 CAACTGAGCCTGCGGGGGCAGGG + Intergenic
1203540636 Un_KI270743v1:84670-84692 CAACTGAGCCTGCGGGGGCAGGG + Intergenic
1203644648 Un_KI270751v1:56199-56221 CAACTGAGCCTGCGGGGGCAGGG - Intergenic
1186602238 X:11050162-11050184 CACTTTAGCCTGCAGTGGTGAGG + Intergenic
1186932744 X:14412733-14412755 CATTTTAGCCCACAGTGGCAAGG - Intergenic
1188027522 X:25226269-25226291 CACTTTGGTCTGCAGTGGCGAGG - Intergenic
1188421203 X:29992347-29992369 CACTTTGGCCTGCAGTGGTGAGG + Intergenic
1188727862 X:33607368-33607390 CTCCTGAGCCTGCAGGGGCAGGG + Intergenic
1188972386 X:36633436-36633458 TACATTAGCCTGCAATGACAAGG + Intergenic
1190537161 X:51440765-51440787 GACTTTAGCCTGCAGTGGCAAGG - Intergenic
1190602737 X:52108963-52108985 CACTTTAGCCTGCAGTGGCAGGG + Intergenic
1191197080 X:57736202-57736224 CACTTCAGCCTGTGGTGGCAAGG - Intergenic
1191694531 X:63976768-63976790 CACTTTAGCCTGCAGTGGCAAGG - Intergenic
1192027078 X:67465411-67465433 CACTTTGGCCCTCAGTGGCAAGG - Intergenic
1192046092 X:67675427-67675449 CACTTTAGCCCACAGTGACAGGG + Intronic
1192077762 X:68017710-68017732 CACTTTAACCCTCAGTGGCAAGG - Intergenic
1192088070 X:68121546-68121568 CACTTTAGCCTGCAGTGTCAAGG - Intronic
1192134967 X:68588690-68588712 CACTTCAGTCTGCAGTTGCAAGG - Intergenic
1192374773 X:70548773-70548795 CACTTTAGCTCTCAGTGGCAAGG - Intronic
1192640395 X:72856882-72856904 CACTTTGTCCTGCGGTGGCAAGG - Intergenic
1192641316 X:72863894-72863916 CACTTTGTCCTGCGGTGGCAAGG + Intergenic
1192826811 X:74705360-74705382 CATTTTAGCCTGTGGTGGCAAGG + Intergenic
1192863644 X:75107216-75107238 CACTTTAGCCTGCAGGGGCAGGG - Intronic
1193191622 X:78578282-78578304 GACTTTAGCCTTCAGTGGCAAGG - Intergenic
1193344483 X:80388872-80388894 CACTTTACCCCACAGTGGCAAGG + Intronic
1193473768 X:81939262-81939284 CACCTTAGGCTGCTGTAACAAGG - Intergenic
1193555844 X:82952518-82952540 CACTTTAACCCACAGTGGCAAGG + Intergenic
1193697334 X:84724688-84724710 CACTGTAGCCTGGGGTGGCAAGG + Intergenic
1193742263 X:85231797-85231819 CACTTTAGCCCACAGTGGCAAGG - Intergenic
1193894793 X:87099983-87100005 CACTTCAGCCTACAGTGGCAGGG - Intergenic
1193986897 X:88253258-88253280 CACTTTGACCTGCAATGGCATGG + Intergenic
1194136550 X:90151429-90151451 CACTTTAGCCCACAATGGCAAGG - Intergenic
1194212110 X:91082204-91082226 CTTCTAAGCCTGCAGGGGCAGGG - Intergenic
1194291146 X:92072926-92072948 CACGTTAGCTTGTGGTGGCAAGG + Intronic
1195115656 X:101695876-101695898 CACTTTAGCCTGCAGTGACAGGG - Intergenic
1195290132 X:103424256-103424278 CACTTTAGCCCACAGTGGCAAGG + Intergenic
1196232556 X:113240650-113240672 CACTTTAGCTCTCAGTGGCAAGG + Intergenic
1196485678 X:116203987-116204009 CACTTCAGCCTGTAGTGGCAAGG + Intergenic
1196510196 X:116500099-116500121 CACTTTAGCCTGTAGTGGTGAGG + Intergenic
1196588658 X:117460219-117460241 CACTTTAGCCTGAGGTGGCAAGG - Intergenic
1196619504 X:117806504-117806526 CACTTTAGCCTGTGGTGGCGAGG - Intergenic
1197342118 X:125287201-125287223 CTTCTGAGCCTGCAGGGGCAGGG - Intergenic
1197382843 X:125766276-125766298 CACTTTCGCCTGAGGTGGCAAGG + Intergenic
1197491921 X:127128534-127128556 CACTTTAGCCTGCACTGGGAAGG - Intergenic
1197558778 X:127991954-127991976 AACTTTAGTCTGCAGTAGCAAGG - Intergenic
1197561842 X:128033931-128033953 CACTTTAGTCTGCAGTGGTGAGG - Intergenic
1197609630 X:128623614-128623636 CCTCTGAGCCTGCAGAGGCAGGG + Intergenic
1198479656 X:137030034-137030056 CACCTTTGCCTGAAATGGTATGG + Intergenic
1198702656 X:139414392-139414414 CACTTTAGCCTGCAGTGACAAGG + Intergenic
1198788088 X:140313344-140313366 CCCCTTGGCCCTCAGTGGCAAGG - Intergenic
1198964734 X:142215333-142215355 CACTTTAGCCTATGGTGGCAAGG + Intergenic
1198996756 X:142581099-142581121 CACTGTAGCCTTCGGTGGCAAGG + Intergenic
1199076315 X:143530376-143530398 CAGTTTAGCCTTTAGTGGCAAGG + Intergenic
1199177602 X:144810281-144810303 CACTTTAGCCCTCCGTGGCAAGG - Intergenic
1199223068 X:145339876-145339898 CAATTTAGCCCTCAGTGGCAGGG - Intergenic
1199277542 X:145964097-145964119 CACTTTAGTCTGCAGTAGCAAGG - Intergenic
1199404457 X:147441088-147441110 CAGCCTAGAGTGCAGTGGCACGG + Intergenic
1199415133 X:147573593-147573615 CACTCGAGCCTGTAGTGGCAAGG - Intergenic
1200215549 X:154366631-154366653 CACTTTTGCCTGCAGTGGGAAGG + Exonic
1200482302 Y:3721379-3721401 CACTTTAGCCCACAATGGCAAGG - Intergenic