ID: 1071966430

View in Genome Browser
Species Human (GRCh38)
Location 10:90857518-90857540
Sequence GGCGCCGCACCTGCTGAGCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 113}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071966430_1071966432 -6 Left 1071966430 10:90857518-90857540 CCTCGCTCAGCAGGTGCGGCGCC 0: 1
1: 0
2: 1
3: 13
4: 113
Right 1071966432 10:90857535-90857557 GGCGCCCAGGAGCCCGCGACCGG 0: 1
1: 0
2: 1
3: 14
4: 172
1071966430_1071966436 -1 Left 1071966430 10:90857518-90857540 CCTCGCTCAGCAGGTGCGGCGCC 0: 1
1: 0
2: 1
3: 13
4: 113
Right 1071966436 10:90857540-90857562 CCAGGAGCCCGCGACCGGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 189
1071966430_1071966443 23 Left 1071966430 10:90857518-90857540 CCTCGCTCAGCAGGTGCGGCGCC 0: 1
1: 0
2: 1
3: 13
4: 113
Right 1071966443 10:90857564-90857586 GCCACCGTCGGGGCTCAAGTCGG 0: 1
1: 1
2: 0
3: 3
4: 46
1071966430_1071966445 24 Left 1071966430 10:90857518-90857540 CCTCGCTCAGCAGGTGCGGCGCC 0: 1
1: 0
2: 1
3: 13
4: 113
Right 1071966445 10:90857565-90857587 CCACCGTCGGGGCTCAAGTCGGG 0: 1
1: 1
2: 0
3: 0
4: 42
1071966430_1071966439 11 Left 1071966430 10:90857518-90857540 CCTCGCTCAGCAGGTGCGGCGCC 0: 1
1: 0
2: 1
3: 13
4: 113
Right 1071966439 10:90857552-90857574 GACCGGGTCGGCGCCACCGTCGG 0: 1
1: 1
2: 0
3: 0
4: 35
1071966430_1071966442 13 Left 1071966430 10:90857518-90857540 CCTCGCTCAGCAGGTGCGGCGCC 0: 1
1: 0
2: 1
3: 13
4: 113
Right 1071966442 10:90857554-90857576 CCGGGTCGGCGCCACCGTCGGGG 0: 1
1: 1
2: 0
3: 2
4: 55
1071966430_1071966433 -5 Left 1071966430 10:90857518-90857540 CCTCGCTCAGCAGGTGCGGCGCC 0: 1
1: 0
2: 1
3: 13
4: 113
Right 1071966433 10:90857536-90857558 GCGCCCAGGAGCCCGCGACCGGG 0: 1
1: 0
2: 0
3: 20
4: 262
1071966430_1071966440 12 Left 1071966430 10:90857518-90857540 CCTCGCTCAGCAGGTGCGGCGCC 0: 1
1: 0
2: 1
3: 13
4: 113
Right 1071966440 10:90857553-90857575 ACCGGGTCGGCGCCACCGTCGGG 0: 1
1: 1
2: 0
3: 1
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071966430 Original CRISPR GGCGCCGCACCTGCTGAGCG AGG (reversed) Exonic
900180172 1:1307759-1307781 GGCGGCGCACCTGAAGCGCGGGG + Exonic
905199403 1:36306238-36306260 GGGGCCGGACCTGCTGAGCCGGG + Intergenic
907069166 1:51518886-51518908 GGCCCGGCACCGGCAGAGCGCGG + Intronic
909457116 1:75862076-75862098 GGCGTGGAACCTGCTGAGCCAGG + Intronic
911079706 1:93916433-93916455 GGCGTGGGACCTGCTGAGCCAGG + Intergenic
911973670 1:104465713-104465735 TGCCCCGGACCTGCTGAGTGCGG - Intergenic
912227133 1:107746662-107746684 GTGGCCGCACCTGCCGAGGGAGG - Intronic
923369356 1:233295316-233295338 GGCCCTGCACCTGGTGAGTGGGG - Exonic
1071698494 10:87903634-87903656 GGCGTAGGACCTGCTGAGCCAGG + Intronic
1071844314 10:89505781-89505803 GGCGTGGAACCTGCTGAGCCAGG - Intronic
1071966430 10:90857518-90857540 GGCGCCGCACCTGCTGAGCGAGG - Exonic
1072516230 10:96186009-96186031 GGCGTGGGACCTGCTGAGCCAGG + Intronic
1073447873 10:103591950-103591972 AGCGCCCCACCTGCTGAGGTCGG + Exonic
1076889396 10:133276468-133276490 GACGCTTCACCTGCTGCGCGAGG - Intronic
1077051437 11:568639-568661 GGGGCGGCACCTGCCGGGCGGGG + Intergenic
1077554589 11:3219762-3219784 GACGCCGCCACTGCTGAGCCTGG - Intergenic
1080802398 11:35619860-35619882 GGCGCTGTAGCAGCTGAGCGTGG - Exonic
1081465309 11:43311577-43311599 GACCCCGCACTTGATGAGCGTGG + Intergenic
1083885813 11:65572972-65572994 GGCGCCGGGCCAGCTGGGCGGGG + Intronic
1084182223 11:67452505-67452527 GGCGCTGCTCCTGCTCAGCCTGG - Exonic
1086644989 11:89209295-89209317 GGCACAGGACCTGCTGAGCCAGG - Intronic
1091219049 11:133919841-133919863 GGCCCCGCCCCTGCTGGGCCTGG - Exonic
1092894935 12:13001630-13001652 GACGCCGCATCTGCTGAGCGGGG + Intergenic
1094791530 12:33920715-33920737 GGCGTGGGACCTGCTGAGCCAGG + Intergenic
1096847171 12:54413646-54413668 GGGGCTGCCCCTGCTGAGAGAGG - Intronic
1099779126 12:87171747-87171769 GGCGTGGCACCTGCCGAGCCAGG - Intergenic
1101819541 12:108173268-108173290 GGCTCCGCACCTGCTCAGGCTGG - Intronic
1101970802 12:109310429-109310451 GGCGGCGCACGGGCAGAGCGCGG + Intergenic
1103933588 12:124463519-124463541 GGTGAGGCACCCGCTGAGCGAGG - Intronic
1104926710 12:132317685-132317707 GGCGCAGCCTCTACTGAGCGAGG - Intronic
1104929227 12:132329437-132329459 GGGGCCGCGCCCTCTGAGCGGGG - Intergenic
1106232310 13:27830146-27830168 GGGGCCGCACCTGCCGGGCGCGG - Intergenic
1109062133 13:57632756-57632778 CGCACCGCACCTGCTGGACGTGG + Exonic
1114554143 14:23551792-23551814 GTCGCTGCACCTGCTCAGTGGGG - Intronic
1120559650 14:85974845-85974867 GGCGTTGGACCTGCTGAGCCAGG + Intergenic
1122153158 14:99735378-99735400 GGCTGCGCAGCTGCTGGGCGGGG - Intergenic
1123162048 14:106287729-106287751 GCCGCCGCACGTGCCGCGCGGGG - Intergenic
1123918852 15:25056634-25056656 TCCGCCGCACATGCTGAGTGGGG + Intergenic
1129332281 15:74833830-74833852 GGCGCAGCTCCTGCTGAATGAGG - Intergenic
1132743852 16:1428728-1428750 GGGGCCGGACCTGCAGAGGGTGG - Intergenic
1133771539 16:8869316-8869338 GGAGCCGCACCTGGCGCGCGTGG - Intergenic
1135342919 16:21664220-21664242 CGCGCCTCACCTGCGGAGCCCGG - Intergenic
1136265103 16:29111576-29111598 GGCACAGCACCAGCAGAGCGGGG + Intergenic
1137262762 16:46844504-46844526 GGCGCTGCCCCAGCTGAACGCGG - Intergenic
1141674399 16:85510048-85510070 GGGGCCCCACCTGCTCAGCGCGG - Intergenic
1142053900 16:87979551-87979573 GGCACAGCACCAGCAGAGCGGGG + Intronic
1142087890 16:88194041-88194063 GGCCCGGCACCTGCAGAGTGTGG + Intergenic
1142172945 16:88632328-88632350 GGCCCCAGACCTGCTGAGCCAGG + Intergenic
1142206346 16:88784940-88784962 GGAGCCGCACGTGCTCGGCGCGG - Exonic
1142501283 17:334714-334736 GGAGCCGCACTTGCTGGGGGTGG - Intronic
1142501313 17:334810-334832 GGAGCCGCACTTGCTGGGGGTGG - Intronic
1143150964 17:4807460-4807482 GGCGGCGCAGCAGCTGCGCGGGG - Intronic
1143563694 17:7709258-7709280 GGCGCTGCTCTTGCTGGGCGTGG + Exonic
1145738329 17:27249539-27249561 GGCGTGGGACCTGCTGAGCCAGG - Intergenic
1145886256 17:28384443-28384465 CGCGCTGCGCCTGCTGGGCGAGG + Exonic
1149191946 17:54073212-54073234 GGCGTGGGACCTGCTGAGCCAGG + Intergenic
1151259337 17:72904509-72904531 GGCCCTGCACCTGCTCAGAGTGG - Intronic
1152644625 17:81463087-81463109 GCCGTGGTACCTGCTGAGCGGGG - Intronic
1152782756 17:82233462-82233484 GGCGCCGCGTCTCCTGAGGGTGG + Intronic
1154147005 18:11874838-11874860 GGCGCAGCACCTGCTGTGGGGGG - Intronic
1160865516 19:1254299-1254321 GCCGCCGCCGCTGCTGCGCGGGG + Exonic
1160935566 19:1592880-1592902 GGCGCCGCGGCTGCGCAGCGCGG - Intergenic
1161134375 19:2611102-2611124 GGCGCCGCACCCGGTGCGAGGGG - Intronic
1161265662 19:3362783-3362805 AGCCCCGCACCTGCTCAGCAAGG - Intronic
1161973302 19:7595866-7595888 GCCGCCGCCGCTGCTGAGCCAGG - Intergenic
1165437923 19:35806803-35806825 GGAGCCGCACGTGCTGGGCCCGG + Exonic
1165449980 19:35876588-35876610 GGGGCCGCAGCTCCTGAGCCAGG - Exonic
1166100033 19:40566224-40566246 GGAGCCGCTCCTGCAGAGCCGGG + Exonic
1166737245 19:45093346-45093368 GGCGCCGCCCGTGCCGGGCGCGG + Exonic
1167300268 19:48673849-48673871 GGCGCGGCACCTGCTGCCCTGGG + Intergenic
1168538522 19:57191701-57191723 GGCGCCGCCCCTGGAGACCGCGG - Exonic
926154954 2:10448468-10448490 GGCGCCCCACCAGCTCCGCGCGG - Exonic
926418125 2:12670853-12670875 GGTGCCACTCCTGCTGAGCAAGG - Intergenic
927027935 2:19089592-19089614 GGCGTGGGACCTGCTGAGCCAGG - Intergenic
934695848 2:96399712-96399734 AGAGCTGCACCTGCTGAGAGTGG - Intergenic
940971950 2:159904731-159904753 CCCGCCCCGCCTGCTGAGCGCGG + Intronic
941917875 2:170823845-170823867 GGCGCCTGGCCTGCTGAGGGTGG + Intronic
945716111 2:213359562-213359584 GGCGTCGGACCTGCTGAGCCAGG + Intronic
949040143 2:241844218-241844240 GCCGCCGCAGCTGCTGTGCGAGG + Intergenic
1169002573 20:2178689-2178711 GGCGACTCACCTGCGGAGCGAGG + Intergenic
1174224084 20:48982783-48982805 GGCGTGGGACCTGCTGAGCCAGG + Intronic
1175824852 20:61931272-61931294 GGAGCTGCACCTGCAGTGCGTGG + Intronic
1178351205 21:31873908-31873930 GGGGCTGCACGTGCTGACCGGGG + Exonic
1181010372 22:20036862-20036884 GGCGCAGCAGATGCAGAGCGAGG - Exonic
1183427629 22:37747892-37747914 GGGGCAGCACGTGCTGAGCAAGG + Intronic
1184067747 22:42129900-42129922 GGCGCCGCAACTGCAGAGGGAGG + Exonic
1184070482 22:42143572-42143594 GGCGCCGCAACTGCAGAGGGAGG + Intergenic
1184148902 22:42627408-42627430 GGCCTCGCACGTGCTGAGCGAGG + Intronic
950034976 3:9878738-9878760 GGAGCAGCAGCTGCTGAGTGAGG - Intronic
950299889 3:11867785-11867807 GGCGTGGGACCTGCTGAGCCAGG + Intergenic
954316598 3:49804807-49804829 GGCGCCGAAGCTGCTCAGAGAGG - Exonic
959692913 3:109218924-109218946 GGCGTGGGACCTGCTGAGCCAGG - Intergenic
961454614 3:127017838-127017860 GGAGACGCAACTGCTGTGCGAGG + Exonic
961830877 3:129622450-129622472 CGCCCAGCACCTGCTGAGCTAGG - Intergenic
961992042 3:131202451-131202473 GGCGTGGGACCTGCTGAGCCAGG - Intronic
963007723 3:140741474-140741496 GGAGCTGGACCTGCTGAGCATGG - Intergenic
966449046 3:180037017-180037039 GCCGCCGCAGCTGCCGAGCGGGG + Intronic
968230445 3:197002459-197002481 GGCCCCGCACCCGCTGGGCCTGG - Exonic
968493286 4:901811-901833 GGCGCCGCTCCCGATTAGCGAGG + Intronic
973888458 4:55346366-55346388 GGCGCTGAACCCGCTGCGCGCGG + Exonic
979264521 4:118685588-118685610 GGCCGCGGACCTGCTGCGCGAGG - Exonic
981300803 4:143184707-143184729 GTCGCCGCACCTGCGCGGCGGGG + Intergenic
987286936 5:16466151-16466173 CGCGCTGCACCTGCGGAGCCGGG + Intergenic
990898917 5:60729175-60729197 GGCGTGGGACCTGCTGAGCCAGG - Intergenic
991575841 5:68102558-68102580 GGCTTCGGACCTGCTGAGCCAGG - Intergenic
992580938 5:78175008-78175030 GGCGTTGGACCTGCTGAGCCAGG + Intronic
998957769 5:147454290-147454312 GGCGCCGCCTCTGCTGCTCGCGG + Intronic
1000065582 5:157690743-157690765 GTCGCCGCCCATGCTGTGCGCGG - Intergenic
1005348302 6:24911020-24911042 CGCGCCGCAGCTGCTGCGAGCGG - Intronic
1006515845 6:34545191-34545213 GGGGCAGCACCTTCTGAGGGAGG - Intronic
1010298029 6:74223099-74223121 GGCGTGGGACCTGCTGAGCCAGG + Intergenic
1016655651 6:146515474-146515496 GGCGTGGGACCTGCTGAGCCAGG + Intergenic
1018947321 6:168356788-168356810 GGGGCCACCCCTGCTGAGCACGG - Intergenic
1018947551 6:168357558-168357580 GGGGCCACCCCTGCTGAGCACGG - Intergenic
1018947741 6:168358162-168358184 GGGGCCACCCCTGCTGAGCACGG - Intergenic
1018947946 6:168358821-168358843 GGGGCCACCCCTGCTGAGCACGG - Intergenic
1019594652 7:1852852-1852874 AGAGCCGCACGTGCTGAGCCTGG + Intronic
1027978354 7:85186412-85186434 GGCTCCGCAGCTGCTGAGGCGGG + Intronic
1034446184 7:151115355-151115377 AGCGCCGCACCTCCTGGCCGCGG - Intronic
1035579164 8:729162-729184 GGCGGAGCATCTGCTGAGTGTGG - Intronic
1035580679 8:737774-737796 CGCCCCGCACCTGCTGAGCCCGG + Intronic
1038437224 8:27544537-27544559 GATGGCACACCTGCTGAGCGTGG - Exonic
1042560426 8:70069620-70069642 GGCGCCTCCCTTGCTGAGCCCGG - Exonic
1044073747 8:87793470-87793492 GGCGTGGCAGCTGCTGAGCCAGG - Intergenic
1048365320 8:133733269-133733291 GGAGTCGCACCTGGGGAGCGGGG - Intergenic
1049299965 8:141864336-141864358 GGCAGGGCACCTGCTGAGCTGGG - Intergenic
1049484831 8:142850289-142850311 GGCGTGGGACCTGCTGAGCCAGG - Intronic
1187181453 X:16946936-16946958 GCCGCCGCTGCTGCTGAGCGAGG + Exonic