ID: 1071967765

View in Genome Browser
Species Human (GRCh38)
Location 10:90869991-90870013
Sequence ATTGAGGGAGGGATTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071967760_1071967765 -10 Left 1071967760 10:90869978-90870000 CCAACTGATTGGTATTGAGGGAG No data
Right 1071967765 10:90869991-90870013 ATTGAGGGAGGGATTGAGGGAGG No data
1071967757_1071967765 -3 Left 1071967757 10:90869971-90869993 CCTATAGCCAACTGATTGGTATT No data
Right 1071967765 10:90869991-90870013 ATTGAGGGAGGGATTGAGGGAGG No data
1071967755_1071967765 16 Left 1071967755 10:90869952-90869974 CCAAAAATAAATGCATGCACCTA No data
Right 1071967765 10:90869991-90870013 ATTGAGGGAGGGATTGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071967765 Original CRISPR ATTGAGGGAGGGATTGAGGG AGG Intergenic