ID: 1071970999

View in Genome Browser
Species Human (GRCh38)
Location 10:90906679-90906701
Sequence AGGTGCCTCTGCCCTAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071970999_1071971002 -6 Left 1071970999 10:90906679-90906701 CCTGAACTAGGGCAGAGGCACCT 0: 1
1: 0
2: 1
3: 18
4: 177
Right 1071971002 10:90906696-90906718 GCACCTAGGATTGGAAAACATGG No data
1071970999_1071971004 28 Left 1071970999 10:90906679-90906701 CCTGAACTAGGGCAGAGGCACCT 0: 1
1: 0
2: 1
3: 18
4: 177
Right 1071971004 10:90906730-90906752 CACTACTTATGTAGTATACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071970999 Original CRISPR AGGTGCCTCTGCCCTAGTTC AGG (reversed) Intronic
901028753 1:6293853-6293875 AGGTGCTTCTGCCCTAGTCCAGG + Intronic
904564888 1:31422868-31422890 AGGGTCCTCTGCCCCAGTTGCGG - Intronic
904594260 1:31633112-31633134 AGGTGGCTCTGCCCCAGCTCAGG + Intronic
906534395 1:46543747-46543769 TGGAGTCTCTCCCCTAGTTCAGG + Intergenic
907152851 1:52305642-52305664 AGGTGCAGCTGCCCAAGTTATGG + Intronic
907774789 1:57503380-57503402 AACTGCCTCTGCCTTAGTTTGGG + Intronic
911377056 1:97063657-97063679 AGTTGCTTCAGGCCTAGTTCAGG + Intergenic
912158230 1:106948731-106948753 CAGTGCCACTGCCTTAGTTCAGG - Intergenic
912984192 1:114410193-114410215 AGGTCCCTCTGCCCTTTCTCCGG - Exonic
914715898 1:150254777-150254799 TGGTGCCTGTGTCCTTGTTCTGG + Intergenic
916527617 1:165626397-165626419 TAGTCCCTTTGCCCTAGTTCAGG - Intergenic
916553708 1:165874670-165874692 AGGTGCCTCTGCCATAAAACAGG + Intronic
920325272 1:205158289-205158311 GGTTTCCTCTGCCCTACTTCTGG + Intronic
921929830 1:220746168-220746190 AGTTGCAAATGCCCTAGTTCAGG - Intergenic
922184608 1:223263185-223263207 AAGGGGCTCTTCCCTAGTTCTGG - Intronic
922945339 1:229509069-229509091 CACTGCCTCTGCCCTGGTTCTGG + Intergenic
923166833 1:231372716-231372738 AGTTTTCTCTGCCCTAGTCCAGG - Intronic
1062854763 10:774430-774452 ATGGGCCTCTGCCCCTGTTCAGG - Intergenic
1064329833 10:14383268-14383290 AGGTGTCTCTGCCATACCTCCGG + Intronic
1066094190 10:32056652-32056674 AAGTGCGTCTGCCTTAGCTCTGG - Intergenic
1066521130 10:36221004-36221026 TTCTGCCGCTGCCCTAGTTCAGG + Intergenic
1067939503 10:50642407-50642429 GAGAGCCTCTGCCCCAGTTCAGG + Intergenic
1069212585 10:65779976-65779998 GAGTGCCACAGCCCTAGTTCAGG - Intergenic
1069832941 10:71292015-71292037 AGGTTCCTCTGCCCTAGTGAGGG - Intronic
1070088144 10:73256483-73256505 AGGTGCCTCTGCCTTAGCTGAGG - Intronic
1070946597 10:80397075-80397097 ATGTGCCTCTATCCCAGTTCTGG - Intergenic
1071970999 10:90906679-90906701 AGGTGCCTCTGCCCTAGTTCAGG - Intronic
1073283889 10:102375555-102375577 AGGTGCATCTGCCCTGGCTGTGG - Exonic
1075638671 10:124048859-124048881 AGCTGCCCCTGCCCTTGTTTAGG - Intronic
1084149371 11:67281027-67281049 AGGTGCCTCTGCCCCAGGGCTGG + Intronic
1085217759 11:74847605-74847627 AGATGCCTCTGCCCCAGCCCAGG - Intronic
1088169351 11:106978135-106978157 AGGTGTCTGTGCCCTACTTGGGG - Intronic
1090665663 11:128913479-128913501 AGGGTCCTCTGCCAGAGTTCAGG - Intronic
1091309486 11:134562466-134562488 AGCTGCCTCTCCGCTTGTTCTGG + Intergenic
1091938603 12:4453925-4453947 AGGTTTCTCTGCCCCAGCTCTGG - Intergenic
1095334848 12:41012145-41012167 AGGTCACTCTGCCCTTGGTCTGG - Intronic
1095640015 12:44476833-44476855 AGGTTTCTCTGCCCTTGGTCTGG + Intergenic
1096047806 12:48579710-48579732 ATCTGCCTCTGCCATAGCTCAGG + Intergenic
1097507009 12:60486027-60486049 AGGTGCCTTCCCCCTTGTTCTGG - Intergenic
1099051718 12:77789089-77789111 AATTGCTTCTGCCTTAGTTCAGG + Intergenic
1102297548 12:111748537-111748559 AGGGGCCCCTGCTCTTGTTCAGG + Intronic
1102960932 12:117092897-117092919 AGGGCCCTCTGCCCTTGTTAGGG - Intronic
1106993242 13:35449355-35449377 GACTGCCACTGCCCTAGTTCAGG - Intronic
1111474415 13:88726081-88726103 AGGTGTCACAGCCCTGGTTCAGG - Intergenic
1111760797 13:92461878-92461900 AGGTGCATCTGTCTTAGCTCAGG - Intronic
1113958694 13:114113294-114113316 AGGTGCATCTGCCCAAGTGCAGG - Intronic
1114530320 14:23391421-23391443 AGGTTCTTCTACCCTAGGTCTGG - Intronic
1117846972 14:59921423-59921445 AATTGCCTCTGCCTTGGTTCAGG - Intronic
1118313372 14:64708730-64708752 TGGAGACCCTGCCCTAGTTCAGG + Intronic
1119996924 14:79263366-79263388 ACATCCCTCTGCCCTAGCTCAGG + Intronic
1120073257 14:80126605-80126627 ATGTGCCTATGCCCCACTTCAGG - Intergenic
1120267425 14:82268970-82268992 AGATGCCTTTGCCCTTCTTCTGG - Intergenic
1120483882 14:85085987-85086009 AGGTGCCTGTGCCCTAATGGTGG + Intergenic
1122369494 14:101221516-101221538 AGGTGACTCTGCTCTTCTTCTGG + Intergenic
1122574987 14:102736352-102736374 AGGTGCTTCTGGCCCAGCTCTGG - Intergenic
1123458423 15:20445978-20446000 AGGTGCTTCTGCCACAGTTTTGG - Intergenic
1123659642 15:22554431-22554453 AGGTGCTTCTGCCACAGTTTTGG + Intergenic
1124264715 15:28222147-28222169 AGGTGCTTCTGCCACAGTTTTGG - Exonic
1124313503 15:28648926-28648948 AGGTGCTTCTGCCACAGTTTTGG + Intergenic
1124797010 15:32791633-32791655 AGGTGTCTCTGCTCTGATTCAGG - Intronic
1125612378 15:40980243-40980265 TGGTGCCTTTGCCCTGTTTCCGG + Exonic
1126785513 15:52175163-52175185 AGTAGCCTCTGCCCTAGTCAGGG - Intronic
1127866314 15:63036165-63036187 AGGTGCCTCTCCTCTACTTGAGG - Intergenic
1129783127 15:78287873-78287895 ACATGCCTCTGCCCTAGTTAGGG - Intronic
1129785353 15:78306564-78306586 AGCTGCCTCCGCCCCAGTTCCGG + Intergenic
1131511690 15:93052601-93052623 GGGTGGCTCTGCCCTAGATGAGG - Intronic
1131571027 15:93536168-93536190 AGGTACATCTCCCCTTGTTCTGG + Intergenic
1135019423 16:18951157-18951179 AACTGCCTCCGCCATAGTTCAGG + Intergenic
1136144926 16:28310956-28310978 TGCTGCCTCTGACCCAGTTCCGG - Intronic
1136458617 16:30396086-30396108 TACTGCCTCTGCCCTACTTCAGG + Intronic
1136764821 16:32768321-32768343 AGGTGCTTCTGCCACAGTTTTGG + Intergenic
1136803278 16:33102063-33102085 AGGTGCTTCTGCCACAGTTTTGG - Intergenic
1137578471 16:49619551-49619573 AAGTGACTATGCCCTAGTTTGGG + Intronic
1140113906 16:72025565-72025587 ATGTGCCTGTGCCTTCGTTCTGG + Intronic
1140968637 16:79991868-79991890 AGGTATCTCTGCCCTAAATCAGG + Intergenic
1142373734 16:89696528-89696550 AGGTGCCTCTGCCCTACCCTCGG - Exonic
1143578228 17:7807615-7807637 AGGTCCCTCTCCCTGAGTTCTGG + Intronic
1146654392 17:34626640-34626662 AGCTGCCCCTGGCCTGGTTCGGG + Intronic
1148151042 17:45396580-45396602 ATGAGCCTCTGCCCTAGACCAGG - Exonic
1148456272 17:47813177-47813199 TGGTCCCTCTGCCCCAGTTCTGG + Intronic
1148674312 17:49436156-49436178 CGCTGCCCCTGCCCTAGTTCAGG + Intronic
1148736977 17:49870336-49870358 AGATCCCTCTGCCCCAGGTCTGG - Intergenic
1148821829 17:50364347-50364369 AGGTGCCTCTGCCCCACCCCTGG - Intergenic
1151115859 17:71734050-71734072 AGCTGTCTCTGCTTTAGTTCAGG + Intergenic
1152709559 17:81864288-81864310 AGGTGCCTCTGCCCTTGGACTGG + Intergenic
1152843450 17:82585105-82585127 AGGGGCCTCTGCCATGGTTTGGG - Intronic
1155059211 18:22213619-22213641 AGGTGCCTCTGCTGAAGTCCTGG + Intergenic
1156005362 18:32434433-32434455 AGATGCCCCTGCCCTAGGCCTGG - Intronic
1157001022 18:43525311-43525333 AGATGTCTGTGCCCTTGTTCTGG + Intergenic
1158774182 18:60556308-60556330 AGGTGTCACAGCCCTAGCTCAGG - Intergenic
1159174311 18:64814053-64814075 AGGTCACTCTGCCCTTGGTCTGG + Intergenic
1159667360 18:71178088-71178110 AGTTTCCTCTGCCCTAGTCCTGG + Intergenic
1161031057 19:2057932-2057954 AGCTGTCTCTGCCCAATTTCTGG + Intergenic
1161636571 19:5392999-5393021 AGGTGCTATTGCACTAGTTCAGG - Intergenic
1164819201 19:31231974-31231996 AGGCTCCTCTGCCCTAGAGCTGG + Intergenic
1166210962 19:41306355-41306377 AGCTGTCTCTGCCCTAGGTGAGG + Intronic
1167035655 19:46993772-46993794 AGGTGGCTCTGCTCTTGCTCAGG - Intronic
926706525 2:15841513-15841535 AGTTCCCTCTGCCATAGGTCTGG + Intergenic
934523075 2:95032091-95032113 GGGTGCCTTTGCACCAGTTCTGG - Intronic
934737754 2:96698582-96698604 AGGTGCCCCAGCCCATGTTCAGG - Intergenic
935783068 2:106524843-106524865 GGGTGCCTCTGCCCTACCCCAGG + Intergenic
936238882 2:110770110-110770132 AGCTGCAGCTACCCTAGTTCAGG - Intronic
938380344 2:130832859-130832881 AGGTGCCCCTGCCCTGGCTCTGG + Intergenic
938951203 2:136256445-136256467 AGAAGCCTCTGCCCCAGTGCAGG + Intergenic
939051040 2:137308214-137308236 AGATGGCTCTGCCCTATTTGAGG + Intronic
940354980 2:152730780-152730802 AGATGCCTCTGCCCTAAGCCTGG - Intronic
941689319 2:168482423-168482445 ATGTGCCTCTCACCTAGTTCAGG + Intronic
941976271 2:171408634-171408656 AGATGACTCTGCCCTACTTAGGG - Intronic
944158501 2:196634286-196634308 AGGTGCCTATGACATACTTCTGG - Intergenic
946197357 2:218042994-218043016 TGGTGCCTTTGCCCAAGTTTTGG + Intronic
948653724 2:239464370-239464392 AGGGGGCTCTGGCCTAGATCCGG + Intergenic
1169340539 20:4793118-4793140 AGCTGCCCCTGCCCTTGTTGTGG - Intronic
1169532183 20:6497106-6497128 AGGTGCCTCTGCCCACATCCAGG - Intergenic
1172748642 20:37233545-37233567 AGGTGCCCATACCCTAGGTCTGG - Intronic
1176993039 21:15521626-15521648 AGGTGTCACTGCCCTGGCTCGGG + Intergenic
1179884929 21:44309819-44309841 AGGTGCCCCTGCCCCATCTCAGG - Intronic
1180696489 22:17754370-17754392 AGGCGCTTCTGCCCTGGTTTCGG + Intronic
1183827806 22:40402091-40402113 AGTTGCCTGTCCCCTAGTTGGGG - Intronic
1185098818 22:48826621-48826643 AGGAGCCGCTGCCCTTGTCCTGG - Intronic
953674683 3:44991710-44991732 AGTTGCCTCTTCCCAAGATCTGG + Intronic
953856128 3:46500383-46500405 CTGGGCCTCTGCCCAAGTTCTGG + Exonic
953916518 3:46924098-46924120 AGGTGCCTGTGCCCTGGTCTTGG - Intronic
958019577 3:87979967-87979989 GAGTGCCTCAGCCCTGGTTCAGG + Intergenic
962411867 3:135147780-135147802 AGCTGCCTCTGCCTTAGCTTGGG - Intronic
963015452 3:140820251-140820273 AGGAGGCTCTGCCATGGTTCAGG - Intergenic
964292903 3:155201382-155201404 AGCTGCCTCTGCTTTAGTTATGG - Intergenic
968546351 4:1200902-1200924 TGGTGCCTCTGCCCTGGATGTGG + Intronic
968612340 4:1563025-1563047 AGCTGCCTCTGCCCCAGCTAGGG + Intergenic
968868141 4:3227048-3227070 GGGTGCCTCTGGCCTTGTCCTGG + Intronic
971192567 4:24441490-24441512 TGGTACCTCTTCCCTACTTCTGG - Intergenic
981315335 4:143335997-143336019 CGGTGCCTCTGCCCTAGCCGAGG + Intergenic
987838021 5:23186555-23186577 AGGGGCATCTGCCCTTGTTGAGG + Intergenic
990103844 5:52230737-52230759 AGGTGAGCCTGCCCTTGTTCTGG + Intergenic
994038516 5:95230015-95230037 AGGAGCATGTGCCTTAGTTCTGG - Intronic
994048086 5:95331587-95331609 AGCTGCCTCGGGCCTAGTACTGG - Intergenic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998337117 5:141383127-141383149 AGCTGCCGCTGCGCTGGTTCAGG - Exonic
998642853 5:144031710-144031732 TGGTGGCACTGCCCTAGTTCAGG + Intergenic
1001735420 5:173994543-173994565 CGCTGCCACTGCCTTAGTTCAGG - Intronic
1006460789 6:34156567-34156589 TGGGGCCTCTGCCCTATTCCAGG + Intergenic
1007784421 6:44271536-44271558 GTGTGCCTCTGCCCTAGTACAGG - Intronic
1011203716 6:84868493-84868515 TGGAGCCTCTGCCCCAGCTCAGG - Intergenic
1011456736 6:87558458-87558480 TGGTTCCTCTGCCCTGGTTTAGG + Intronic
1013113671 6:107084207-107084229 AGGTTTCCCTGCCCTAGTGCTGG - Intronic
1013370086 6:109461833-109461855 AAAAGCCTGTGCCCTAGTTCTGG + Intergenic
1013883087 6:114928902-114928924 AGGGGCGTCTGCCATTGTTCAGG - Intergenic
1018203446 6:161415632-161415654 AGGTGGCTGTGGCTTAGTTCCGG - Intronic
1018329350 6:162710694-162710716 AGGGGCCTCTGCAGCAGTTCTGG - Intronic
1018555786 6:165049542-165049564 AGGTCACTCTGCCCTTGTTCCGG + Intergenic
1020004517 7:4775332-4775354 AAGTGTCACTGCCCCAGTTCTGG - Intronic
1022511570 7:30938115-30938137 TGGTGCCTCTGCCCCAGTGGGGG + Intergenic
1022891801 7:34708674-34708696 AGATGCCTCTGCCCAAGTATTGG + Intronic
1022979769 7:35593693-35593715 AGGTGCCTATGCCCTCGCCCCGG + Intergenic
1024090408 7:45935066-45935088 AGGTGCCTCAGCTCTGGGTCAGG + Intergenic
1027739373 7:81980723-81980745 AGCTGCCTCTGCCCTAATCCAGG - Intronic
1027958360 7:84911512-84911534 AGGTAATTCTGCCCTAGTTAAGG - Intergenic
1028164334 7:87520587-87520609 AGATGTCCCTGCCTTAGTTCAGG + Intronic
1028364864 7:90016129-90016151 AGGGAACTCTCCCCTAGTTCAGG + Intergenic
1032141651 7:129336682-129336704 AACTGCCACTGCCCCAGTTCTGG - Intronic
1034897046 7:154882853-154882875 AGGTGCCCCTGCCCTATTAAAGG + Intronic
1035782436 8:2239273-2239295 AGCCCCCTCTGCCTTAGTTCTGG + Intergenic
1038352903 8:26796756-26796778 ATGTGCCTGTGCCCGATTTCAGG - Intronic
1038359907 8:26865860-26865882 AGTCACCTCTGCCCGAGTTCAGG + Intronic
1040392522 8:46962017-46962039 AGGGGCCTCTGCCCTCGTGGAGG - Intergenic
1042560230 8:70068425-70068447 AGTTGACTCTGCATTAGTTCAGG + Intronic
1044693308 8:94899698-94899720 ATTTCCCTCTGCCTTAGTTCAGG + Intronic
1045055189 8:98362625-98362647 AGCAGCCTTTGCCCTAGATCTGG - Intergenic
1046016373 8:108610104-108610126 AGGTTCCTAGGTCCTAGTTCAGG - Intronic
1046503605 8:115110632-115110654 TGGTGCCTTTGCCCAAGTTTCGG + Intergenic
1048360563 8:133694037-133694059 GGATGCCTCTGCCCTTGGTCTGG - Intergenic
1048830825 8:138475637-138475659 CGCTGCCTCTGCCTTAGTTCAGG + Intronic
1048990789 8:139759002-139759024 AGGTGCCTCTGTTCTCTTTCTGG + Intronic
1049611890 8:143559686-143559708 AGGTCCCTCTGCCCTGGGGCTGG + Intronic
1049615936 8:143575835-143575857 AGGTGCCAGTGCCCTAGGTGGGG + Intronic
1050897070 9:10896896-10896918 ATCTGCCTCTGCTCTATTTCAGG + Intergenic
1051125850 9:13804906-13804928 AACAGCCTCTGCCCTAGTTAAGG + Intergenic
1052060734 9:23958284-23958306 AGATGTCCATGCCCTAGTTCTGG + Intergenic
1052986912 9:34494497-34494519 AGGGGCCACTGGCCTAGGTCAGG + Intronic
1053083105 9:35193950-35193972 AGGTCACTCTGCCCTTGGTCTGG - Intronic
1053083117 9:35194034-35194056 AGGTCACTCTGCCCTTGGTCTGG - Intronic
1055360161 9:75481092-75481114 TGGTGCCACTACCCTAGTGCAGG - Intergenic
1058428648 9:104898718-104898740 GGGTGCCTGTCCCCTAGGTCAGG - Intronic
1059668550 9:116472347-116472369 AGGTGCCTTTGAGCTAGGTCTGG - Intronic
1059704625 9:116809972-116809994 AGCTGCCTCTTCCCTTGTTATGG + Intronic
1060839616 9:126783223-126783245 TGTCTCCTCTGCCCTAGTTCAGG - Intergenic
1061227517 9:129289299-129289321 AGGAGCCTCTACCCTGGCTCAGG - Intergenic
1185575612 X:1169782-1169804 AGGTGCTTCTGCTCTAATTTTGG + Intergenic
1188159591 X:26783712-26783734 AGGTCACTCTGCCCTTGGTCTGG - Intergenic
1190119112 X:47645901-47645923 ATGTTCCTCTGCCCCTGTTCTGG + Intronic
1197356187 X:125439393-125439415 AGGTCACTCTGCCCTTGGTCTGG - Intergenic
1198443843 X:136691684-136691706 TGCTGCCACTGCCTTAGTTCAGG + Intronic
1198446048 X:136715625-136715647 AGGTTTTTCTGCCCTAGTGCTGG - Intronic
1198747344 X:139903833-139903855 GGTTGTCTTTGCCCTAGTTCAGG - Intronic
1198759801 X:140019358-140019380 AGCTGCTTCTGCCCTAGACCTGG + Intergenic
1198778984 X:140214692-140214714 AGCTGCTTCTGCCCTAGACCTGG - Intergenic
1199865858 X:151849323-151849345 AGGGGGCACTGCCCTAGCTCTGG - Intergenic
1200107447 X:153723093-153723115 GGGTGCCTGTGCCCTAGCCCTGG - Intronic