ID: 1071971478

View in Genome Browser
Species Human (GRCh38)
Location 10:90912068-90912090
Sequence AAGTCCTTCTATAAGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071971478 Original CRISPR AAGTCCTTCTATAAGTGTGG TGG (reversed) Intergenic
908380440 1:63593159-63593181 AACTCCTCCTCTAAGTGTTGGGG - Intronic
911268753 1:95775373-95775395 TAGTCCTTCTATCTGTCTGGTGG + Intergenic
912638466 1:111320828-111320850 AAGTGCTTCTGTAAGACTGGGGG + Intergenic
915862448 1:159459644-159459666 AAGTCATTCAATAAGTGAGAAGG + Intergenic
916549501 1:165836574-165836596 AATTCCTTTTACAAGTCTGGAGG - Intronic
916567043 1:165990026-165990048 ATGTCCTTCTATAAGTGAGAGGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
922786367 1:228284378-228284400 AAGTGCTTCCATATGAGTGGTGG - Intronic
1062903692 10:1165578-1165600 CAGTGCTGCGATAAGTGTGGGGG + Intergenic
1063054493 10:2489609-2489631 AAGTCTTTCTCATAGTGTGGAGG + Intergenic
1065237933 10:23672866-23672888 AAGTCCTTCTATTACTCAGGAGG + Intergenic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1067922185 10:50470619-50470641 AAGTCTTTCCTTAAGTGTAGTGG - Intronic
1070452540 10:76576376-76576398 CAGTCCTTCATTAAGTGAGGTGG + Intergenic
1071926008 10:90409682-90409704 CAATCCTTCTATAGGTGAGGGGG + Intergenic
1071971478 10:90912068-90912090 AAGTCCTTCTATAAGTGTGGTGG - Intergenic
1075052417 10:119192536-119192558 AAGTCTTTTTAAAAGGGTGGAGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078354775 11:10625477-10625499 AAGTCCATCTGCAAGTGTGAAGG - Intronic
1081589449 11:44410969-44410991 AAGTCCATCCATAAATGTGAGGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1084646657 11:70463130-70463152 AAGTCCCTCCTTCAGTGTGGGGG - Intergenic
1085363856 11:75918977-75918999 AACTCTTTCTATAAGTGTTTTGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091726373 12:2849223-2849245 AAGCCCTTCTAGAAGTGTCCAGG + Intronic
1092496110 12:8996693-8996715 AAAGCCTTCTCTAAGTGAGGTGG + Intronic
1095512413 12:42966800-42966822 CACTCCTTCTATCAGTGAGGAGG - Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097314658 12:58159271-58159293 AAGTCCTTGTATAAGTTGAGGGG + Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101425768 12:104586967-104586989 AAGTTCTTCTACTACTGTGGGGG + Intronic
1108757663 13:53523198-53523220 AGGTCCTTCTCAAAGTTTGGTGG - Intergenic
1114851286 14:26385257-26385279 AAATCCTTCTATTTGAGTGGAGG - Intergenic
1117715337 14:58574404-58574426 AAGTCCTTCAATAAGACTAGAGG + Intergenic
1121191910 14:92038396-92038418 AAGGGCTTCTTTATGTGTGGGGG - Intronic
1121244401 14:92451680-92451702 AACGCCTTTTATCAGTGTGGTGG - Intronic
1125366679 15:38924631-38924653 AATTCCTTGTATGTGTGTGGGGG - Intergenic
1126570452 15:50144903-50144925 AACTGCTTCCATAAGTGTAGAGG - Intronic
1129659333 15:77544234-77544256 CAGCCCTTCTATCTGTGTGGAGG - Intergenic
1130751810 15:86720483-86720505 AATTCCTTCCATAAGTGGAGTGG - Intronic
1130954656 15:88619129-88619151 AAATCCTTCTACAAGTCAGGTGG - Intergenic
1131426399 15:92348514-92348536 AAGTCCTTCTATAGTTGGGAAGG - Intergenic
1137055024 16:35741231-35741253 AAGTCCTTTTGCAAGAGTGGGGG + Intergenic
1138944539 16:61831999-61832021 CAATACTTCTATAAGTGGGGGGG + Intronic
1139671790 16:68497288-68497310 GAGTCCTTCTTTAGGTCTGGAGG - Intergenic
1141940816 16:87274848-87274870 AATTCCTCATATAACTGTGGAGG + Intronic
1146092336 17:29892279-29892301 AATTCCTTTTATAGGTGAGGTGG - Intronic
1146110048 17:30081146-30081168 AAGTCCTTCCATAAGTAATGGGG - Intronic
1152318962 17:79597365-79597387 AAGCCCTTCTACAAGTCTGTAGG - Intergenic
1155106002 18:22667102-22667124 AGATCTTTCTATTAGTGTGGAGG + Intergenic
1156260668 18:35442900-35442922 ATGTGCTTCGATCAGTGTGGTGG + Intergenic
1157735940 18:50049113-50049135 AAGTCTTTCTAAAACAGTGGTGG - Intronic
1159632234 18:70762388-70762410 AAGGTCATCTGTAAGTGTGGGGG + Intergenic
1165370053 19:35399448-35399470 AAGTTATTCTTTAAGTGTAGAGG - Intergenic
1166896375 19:46024300-46024322 ATGTCCTTATATAAGTTTGTAGG - Intergenic
1168397279 19:56059234-56059256 CAGTCCTTGTACAAGTCTGGAGG + Intronic
928728592 2:34204993-34205015 AAGTCTTTTAATAACTGTGGGGG + Intergenic
928967420 2:36991024-36991046 AAGTACTACTATAAATGTTGTGG - Intronic
931928320 2:67099451-67099473 AAATCCTTCTCTATGTGTGTAGG + Intergenic
938550935 2:132381864-132381886 AAGATCTTCTTGAAGTGTGGTGG + Intergenic
939378306 2:141399589-141399611 AAGTGTTTCTATAGGTTTGGGGG - Intronic
941398140 2:164996363-164996385 AAGCCCTTTTATAAGAGAGGTGG + Intergenic
942078828 2:172381645-172381667 CAGACCTTCCTTAAGTGTGGAGG - Intergenic
946076311 2:217076676-217076698 AAGTCTTTCTGAAAGTGGGGGGG - Intergenic
947705572 2:232272923-232272945 AAATGCTTCTAGAAGTGGGGTGG - Intronic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1175461784 20:59157318-59157340 AAGTCCTACTGAAAGTGTGGGGG + Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1184875064 22:47269176-47269198 AAGTCCTTCTATGAGGGGTGTGG + Intergenic
949116326 3:329428-329450 AAGTCCTTATATAATTCTAGAGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
954718095 3:52536897-52536919 GAGACCTTCTGTAAGTGAGGGGG + Exonic
964147602 3:153484168-153484190 AATTCCTCCTGTAAGTGTGTGGG + Intergenic
964914521 3:161823831-161823853 AAGTCATCCTACAGGTGTGGGGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
968722356 4:2216998-2217020 AAGTCATCCTATTAATGTGGTGG + Intronic
970404212 4:15746878-15746900 AAGTCCTTATTTAACTGAGGGGG + Intergenic
976223048 4:82773455-82773477 AAGTCCTTCTGCAAGTGGAGGGG + Intronic
982378018 4:154715973-154715995 ATTTCCTTCTGTAAGAGTGGAGG - Intronic
983416722 4:167466160-167466182 AAGTCCCTCTATATATTTGGAGG + Intergenic
986871782 5:12056659-12056681 AAGTCCTTCTGAAGGTGTGTGGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990354947 5:54957814-54957836 GAGACCTACTAGAAGTGTGGTGG - Exonic
992068633 5:73129760-73129782 AAGCCCTTCTGTAACTGTTGGGG - Intronic
994058106 5:95442686-95442708 AAGTCTTTCTATCAGAGTGGAGG + Intronic
994888981 5:105604987-105605009 ATTTGCTTCTATATGTGTGGGGG + Intergenic
1004246331 6:13980171-13980193 AAGGCCTTTTAAAAGTGTGATGG - Exonic
1008415442 6:51234531-51234553 TAGTCCTTCTGGAAATGTGGAGG - Intergenic
1008573382 6:52836164-52836186 AAGTCCTTCTTTGAGTGGGTGGG - Intronic
1010988886 6:82457360-82457382 AAGTCTTTCCATAAGTCTAGAGG + Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1013199396 6:107878492-107878514 AAGGCATTCTCTAAGTGGGGAGG - Intronic
1015439159 6:133227660-133227682 TATTGCTTCTATAAGTGTGCTGG + Intergenic
1020899209 7:13983099-13983121 AACTCCTACTCGAAGTGTGGAGG + Intronic
1023626488 7:42119986-42120008 AACTCCCTCTATAAGTGCGAGGG - Intronic
1024219102 7:47273876-47273898 TCGTCCTTCTATTAATGTGGTGG - Intergenic
1025624760 7:63210908-63210930 ACGCCCTTGTATAATTGTGGTGG - Intergenic
1028042604 7:86073912-86073934 GAATCCTTCTATAAGAGTGAGGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031459593 7:122030472-122030494 AGATCCTTCTATAAGTGTGAAGG + Intronic
1036809352 8:11856942-11856964 ATGTCCTTTTATCAGTTTGGTGG - Intronic
1043923330 8:86008964-86008986 AAGTGCTTCTATTATTGTGTCGG - Intronic
1048435696 8:134415144-134415166 AAGGCATTCTATGAGTGTGAGGG + Intergenic
1048785947 8:138050437-138050459 AAGTACTTTTGTAAGAGTGGTGG - Intergenic
1049534134 8:143170219-143170241 GAGTCCCTGTATAAGAGTGGGGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051231104 9:14956671-14956693 AACTCCTCCTCTAAGAGTGGTGG - Intergenic
1055583244 9:77730244-77730266 ACTTCCTTGTATAAGTTTGGAGG - Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1186246109 X:7618619-7618641 AATGCCTTCTATAAATATGGTGG - Intergenic
1187014539 X:15313087-15313109 AAGTCTTTCTATAAGAATGTAGG - Intronic
1196282091 X:113833674-113833696 AAGGCCTTCTATCAGTGTAGGGG - Intergenic
1196667524 X:118332027-118332049 AAGTCATTCTGTAAATGAGGGGG - Intergenic
1197155056 X:123261632-123261654 TTGTCCTTCTATAGGGGTGGGGG - Intronic
1201494260 Y:14576207-14576229 CAGGCCTTCTTGAAGTGTGGTGG + Intronic
1202268103 Y:23042137-23042159 AACTCTTTCTATGAGTTTGGTGG - Intergenic
1202421095 Y:24675881-24675903 AACTCTTTCTATGAGTTTGGTGG - Intergenic
1202449691 Y:24994201-24994223 AACTCTTTCTATGAGTTTGGTGG + Intergenic