ID: 1071976655

View in Genome Browser
Species Human (GRCh38)
Location 10:90962566-90962588
Sequence TAGTGCTCACATAAGGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071976655_1071976659 -2 Left 1071976655 10:90962566-90962588 CCACAGGCCTTATGTGAGCACTA No data
Right 1071976659 10:90962587-90962609 TAATAAGGTGACATCTGTTTGGG No data
1071976655_1071976661 14 Left 1071976655 10:90962566-90962588 CCACAGGCCTTATGTGAGCACTA No data
Right 1071976661 10:90962603-90962625 GTTTGGGATACAGGATTACAAGG No data
1071976655_1071976662 29 Left 1071976655 10:90962566-90962588 CCACAGGCCTTATGTGAGCACTA No data
Right 1071976662 10:90962618-90962640 TTACAAGGATGATGTATATGTGG No data
1071976655_1071976658 -3 Left 1071976655 10:90962566-90962588 CCACAGGCCTTATGTGAGCACTA No data
Right 1071976658 10:90962586-90962608 CTAATAAGGTGACATCTGTTTGG No data
1071976655_1071976663 30 Left 1071976655 10:90962566-90962588 CCACAGGCCTTATGTGAGCACTA No data
Right 1071976663 10:90962619-90962641 TACAAGGATGATGTATATGTGGG No data
1071976655_1071976660 5 Left 1071976655 10:90962566-90962588 CCACAGGCCTTATGTGAGCACTA No data
Right 1071976660 10:90962594-90962616 GTGACATCTGTTTGGGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071976655 Original CRISPR TAGTGCTCACATAAGGCCTG TGG (reversed) Intergenic
No off target data available for this crispr