ID: 1071976906

View in Genome Browser
Species Human (GRCh38)
Location 10:90964514-90964536
Sequence CTTCTGGGTCACCACAGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071976906_1071976917 28 Left 1071976906 10:90964514-90964536 CCTTGACTGTGGTGACCCAGAAG No data
Right 1071976917 10:90964565-90964587 TATCTCTCCTCTGGAGACTTTGG No data
1071976906_1071976914 19 Left 1071976906 10:90964514-90964536 CCTTGACTGTGGTGACCCAGAAG No data
Right 1071976914 10:90964556-90964578 GTCCAACCTTATCTCTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071976906 Original CRISPR CTTCTGGGTCACCACAGTCA AGG (reversed) Intergenic
No off target data available for this crispr