ID: 1071978906

View in Genome Browser
Species Human (GRCh38)
Location 10:90983766-90983788
Sequence ATGTAAATACCTATGAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071978902_1071978906 -5 Left 1071978902 10:90983748-90983770 CCTTCTCTAACCTGAGAAATGTA No data
Right 1071978906 10:90983766-90983788 ATGTAAATACCTATGAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071978906 Original CRISPR ATGTAAATACCTATGAAGGT GGG Intergenic
No off target data available for this crispr