ID: 1071981874

View in Genome Browser
Species Human (GRCh38)
Location 10:91011541-91011563
Sequence ATGTTTCAACCTAATATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071981874_1071981877 -3 Left 1071981874 10:91011541-91011563 CCCCAAATATTAGGTTGAAACAT No data
Right 1071981877 10:91011561-91011583 CATATGAAACTCATTTATATAGG No data
1071981874_1071981878 6 Left 1071981874 10:91011541-91011563 CCCCAAATATTAGGTTGAAACAT No data
Right 1071981878 10:91011570-91011592 CTCATTTATATAGGCCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071981874 Original CRISPR ATGTTTCAACCTAATATTTG GGG (reversed) Intergenic
No off target data available for this crispr