ID: 1071982900

View in Genome Browser
Species Human (GRCh38)
Location 10:91021824-91021846
Sequence TGTCCCTCTGTCACAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071982900_1071982906 18 Left 1071982900 10:91021824-91021846 CCTCCCTCTGTGACAGAGGGACA No data
Right 1071982906 10:91021865-91021887 AGGCTGGCCTCCATACTAGCAGG No data
1071982900_1071982903 -7 Left 1071982900 10:91021824-91021846 CCTCCCTCTGTGACAGAGGGACA No data
Right 1071982903 10:91021840-91021862 AGGGACATTGCTGTTATCTCAGG No data
1071982900_1071982907 23 Left 1071982900 10:91021824-91021846 CCTCCCTCTGTGACAGAGGGACA No data
Right 1071982907 10:91021870-91021892 GGCCTCCATACTAGCAGGCCTGG No data
1071982900_1071982904 -2 Left 1071982900 10:91021824-91021846 CCTCCCTCTGTGACAGAGGGACA No data
Right 1071982904 10:91021845-91021867 CATTGCTGTTATCTCAGGCTAGG No data
1071982900_1071982908 24 Left 1071982900 10:91021824-91021846 CCTCCCTCTGTGACAGAGGGACA No data
Right 1071982908 10:91021871-91021893 GCCTCCATACTAGCAGGCCTGGG No data
1071982900_1071982905 2 Left 1071982900 10:91021824-91021846 CCTCCCTCTGTGACAGAGGGACA No data
Right 1071982905 10:91021849-91021871 GCTGTTATCTCAGGCTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071982900 Original CRISPR TGTCCCTCTGTCACAGAGGG AGG (reversed) Intergenic
No off target data available for this crispr