ID: 1071983781

View in Genome Browser
Species Human (GRCh38)
Location 10:91030520-91030542
Sequence AACCCAGTGCTGTGATTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071983781_1071983782 10 Left 1071983781 10:91030520-91030542 CCACTGAATCACAGCACTGGGTT No data
Right 1071983782 10:91030553-91030575 CATTTCCACAGTGCCCTGCATGG No data
1071983781_1071983786 24 Left 1071983781 10:91030520-91030542 CCACTGAATCACAGCACTGGGTT No data
Right 1071983786 10:91030567-91030589 CCTGCATGGACCTCAAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071983781 Original CRISPR AACCCAGTGCTGTGATTCAG TGG (reversed) Intergenic
No off target data available for this crispr