ID: 1071983786

View in Genome Browser
Species Human (GRCh38)
Location 10:91030567-91030589
Sequence CCTGCATGGACCTCAAACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071983781_1071983786 24 Left 1071983781 10:91030520-91030542 CCACTGAATCACAGCACTGGGTT No data
Right 1071983786 10:91030567-91030589 CCTGCATGGACCTCAAACTTTGG No data
1071983778_1071983786 27 Left 1071983778 10:91030517-91030539 CCTCCACTGAATCACAGCACTGG No data
Right 1071983786 10:91030567-91030589 CCTGCATGGACCTCAAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071983786 Original CRISPR CCTGCATGGACCTCAAACTT TGG Intergenic
No off target data available for this crispr