ID: 1071986516

View in Genome Browser
Species Human (GRCh38)
Location 10:91056674-91056696
Sequence AAGTGTGACCAGGGTGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071986516_1071986525 13 Left 1071986516 10:91056674-91056696 CCATTATCACCCTGGTCACACTT No data
Right 1071986525 10:91056710-91056732 AACCTTGACTGCTGGGCTCCTGG No data
1071986516_1071986523 6 Left 1071986516 10:91056674-91056696 CCATTATCACCCTGGTCACACTT No data
Right 1071986523 10:91056703-91056725 GGCTTCCAACCTTGACTGCTGGG No data
1071986516_1071986528 26 Left 1071986516 10:91056674-91056696 CCATTATCACCCTGGTCACACTT No data
Right 1071986528 10:91056723-91056745 GGGCTCCTGGTTTGGCTTCTTGG No data
1071986516_1071986527 18 Left 1071986516 10:91056674-91056696 CCATTATCACCCTGGTCACACTT No data
Right 1071986527 10:91056715-91056737 TGACTGCTGGGCTCCTGGTTTGG No data
1071986516_1071986522 5 Left 1071986516 10:91056674-91056696 CCATTATCACCCTGGTCACACTT No data
Right 1071986522 10:91056702-91056724 GGGCTTCCAACCTTGACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071986516 Original CRISPR AAGTGTGACCAGGGTGATAA TGG (reversed) Intergenic
No off target data available for this crispr