ID: 1071989071

View in Genome Browser
Species Human (GRCh38)
Location 10:91082020-91082042
Sequence CCCCTAATCAAAATAACCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071989071_1071989074 -10 Left 1071989071 10:91082020-91082042 CCATAGGTTATTTTGATTAGGGG No data
Right 1071989074 10:91082033-91082055 TGATTAGGGGTAAGGACATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071989071 Original CRISPR CCCCTAATCAAAATAACCTA TGG (reversed) Intergenic
No off target data available for this crispr