ID: 1071992518

View in Genome Browser
Species Human (GRCh38)
Location 10:91113824-91113846
Sequence GTGGCAAACGGGACTTAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071992513_1071992518 25 Left 1071992513 10:91113776-91113798 CCAAAATACTTTGAAAAGTAATA No data
Right 1071992518 10:91113824-91113846 GTGGCAAACGGGACTTAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071992518 Original CRISPR GTGGCAAACGGGACTTAGAA GGG Intergenic
No off target data available for this crispr