ID: 1071996469

View in Genome Browser
Species Human (GRCh38)
Location 10:91153913-91153935
Sequence GCGCACTCTCGCTGCCGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071996465_1071996469 1 Left 1071996465 10:91153889-91153911 CCAGGGGCGTACCACGACCGGGC No data
Right 1071996469 10:91153913-91153935 GCGCACTCTCGCTGCCGCCCTGG No data
1071996462_1071996469 12 Left 1071996462 10:91153878-91153900 CCGCGGGGTTGCCAGGGGCGTAC No data
Right 1071996469 10:91153913-91153935 GCGCACTCTCGCTGCCGCCCTGG No data
1071996466_1071996469 -10 Left 1071996466 10:91153900-91153922 CCACGACCGGGCCGCGCACTCTC No data
Right 1071996469 10:91153913-91153935 GCGCACTCTCGCTGCCGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071996469 Original CRISPR GCGCACTCTCGCTGCCGCCC TGG Intergenic
No off target data available for this crispr