ID: 1072007365

View in Genome Browser
Species Human (GRCh38)
Location 10:91266109-91266131
Sequence TACCCAATACTGTTGAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072007360_1072007365 29 Left 1072007360 10:91266057-91266079 CCAAAATGTTCCAGGTACCAGGT 0: 1
1: 0
2: 2
3: 11
4: 134
Right 1072007365 10:91266109-91266131 TACCCAATACTGTTGAGGAATGG No data
1072007361_1072007365 19 Left 1072007361 10:91266067-91266089 CCAGGTACCAGGTACAGATTGCA 0: 1
1: 0
2: 0
3: 2
4: 113
Right 1072007365 10:91266109-91266131 TACCCAATACTGTTGAGGAATGG No data
1072007363_1072007365 12 Left 1072007363 10:91266074-91266096 CCAGGTACAGATTGCACAGGTAG 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1072007365 10:91266109-91266131 TACCCAATACTGTTGAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072007365 Original CRISPR TACCCAATACTGTTGAGGAA TGG Intronic
No off target data available for this crispr