ID: 1072007797

View in Genome Browser
Species Human (GRCh38)
Location 10:91271727-91271749
Sequence TCACCGCCATGGTGTCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 68}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072007797 Original CRISPR TCACCGCCATGGTGTCATGA TGG (reversed) Intronic
902664790 1:17929953-17929975 ACCCCTCCAGGGTGTCATGATGG - Intergenic
903174678 1:21573838-21573860 ACACGGCCCTGGTGTCAGGATGG + Intronic
905459211 1:38111381-38111403 ACACAGCCATGGTGACAAGACGG + Intergenic
906667205 1:47630416-47630438 TCACTGCCATGCTGTCCTGCAGG + Intergenic
910712458 1:90195982-90196004 TCCCTGCCTTGGTTTCATGAAGG + Intergenic
911412211 1:97524056-97524078 ATACCGCAAAGGTGTCATGAAGG + Intronic
912071724 1:105818876-105818898 TCACCGCCATGGTATTATATCGG + Intergenic
920339184 1:205265069-205265091 ACACCTCCTTGGTGACATGAAGG - Intronic
922064168 1:222120544-222120566 TCACAACCATGAGGTCATGAGGG - Intergenic
1064190023 10:13197706-13197728 TCACCTCCAGGATGTCCTGAGGG - Exonic
1064987113 10:21221918-21221940 TCAACGCCATGCAGTCAGGATGG - Intergenic
1065079732 10:22116237-22116259 TCACAGCAATGGTGTGATCATGG + Intergenic
1066008213 10:31167885-31167907 TCACCAACATCGTGACATGAAGG - Intergenic
1066311308 10:34199504-34199526 TCATGGCCATGGTTTCATGAGGG + Intronic
1070687589 10:78500630-78500652 TCAGCCCCATTGTGTCATTAGGG - Intergenic
1072007797 10:91271727-91271749 TCACCGCCATGGTGTCATGATGG - Intronic
1077366210 11:2162361-2162383 TCACCCCCATAGTGTCATCTGGG + Intergenic
1077471365 11:2762189-2762211 TCTCCGTGATGGTCTCATGAAGG - Intronic
1083187361 11:61025547-61025569 TCACCGTCATATTGTCATCATGG - Intergenic
1085058249 11:73420886-73420908 TTACCTTCATGGTGTCCTGAGGG + Intronic
1085715013 11:78864739-78864761 TTACATCCAGGGTGTCATGAGGG - Intronic
1090315631 11:125785501-125785523 TCACCACCATGTTGTCACCAGGG + Intergenic
1095519311 12:43043030-43043052 ACCCAGCCATGGAGTCATGATGG + Intergenic
1107092106 13:36492962-36492984 TCACAGCCATGATGTCTTTAAGG - Intergenic
1113794473 13:113049140-113049162 TCACAGCCCTGGTTTCATGAAGG + Intronic
1114877334 14:26736894-26736916 TAACAGCCCTGGTGTCAGGAGGG - Intergenic
1119929376 14:78530178-78530200 TCACAGCCCTGGTGTCTGGAGGG - Intronic
1120881589 14:89418122-89418144 TCACCACCAGGGTGTCCTGTTGG - Intronic
1121666202 14:95674346-95674368 TCACCACCATTTTTTCATGATGG - Intergenic
1128806639 15:70536056-70536078 TCACAGCAATGGTGTGATGCAGG + Intergenic
1132620593 16:866375-866397 CCCCCGCCATAGTGTCATGGAGG - Intronic
1140681869 16:77393128-77393150 TCACCTCCATGGTGACCAGATGG - Intronic
1141579043 16:84984742-84984764 TCACGGGCATGGTGTCCTGGGGG + Intronic
1146180320 17:30693939-30693961 CCACCGCCAGGGTGTCAGGCGGG + Intergenic
1151760714 17:76101205-76101227 TCTCTGCCCTGGTCTCATGAGGG - Intronic
1159805631 18:72955184-72955206 TGACTGCCATGGTGTTTTGATGG + Intergenic
1160359955 18:78266801-78266823 CCAAGGCCAAGGTGTCATGAGGG - Intergenic
1160454269 18:78987623-78987645 TCACACCCATGGTGCCATGTTGG - Intronic
1162978283 19:14221601-14221623 CCACCGCCAGGGTGTCAGGCCGG - Intergenic
938542524 2:132296298-132296320 GCCCAGCCATGGTGACATGAAGG - Intergenic
947314863 2:228845562-228845584 TGACCTCCATGGTGACAGGATGG - Intergenic
1169512486 20:6279208-6279230 TCCTTGCCATGGTGTCATGGTGG + Intergenic
1171871405 20:30529145-30529167 GCCCAGCCATGGTGACATGAAGG - Intergenic
1175543741 20:59764446-59764468 TCCCCACCATGGTTTCATGTTGG + Intronic
1180701082 22:17781749-17781771 TCACCCCCATGGTGAAATCACGG + Intergenic
1181180878 22:21067562-21067584 TCACAGCCATGGAGACATGGGGG - Intergenic
1181444467 22:22958277-22958299 TCATCGCTATGGTGACATGATGG - Intergenic
1184730239 22:46367667-46367689 TCACAGCGATGGTGTCACGGCGG + Intronic
950052607 3:10003794-10003816 ACACCACCATGGCCTCATGAGGG + Intronic
950226075 3:11235584-11235606 CCACCCCCATGGTGTCAGTAGGG - Intronic
954149992 3:48652538-48652560 CCACCGCCATGGTGTCCTGGAGG + Exonic
954603271 3:51888894-51888916 ACAGCGCCATGATGTCATCACGG - Intergenic
956757404 3:72402488-72402510 TCACCGCCTTATTGTTATGAGGG - Intronic
959883693 3:111474746-111474768 TCAAAGTCATGGTGTCATGTTGG + Intronic
966750638 3:183318260-183318282 TCACCAACATGCTGTCTTGATGG + Intronic
972342896 4:38167851-38167873 TCAGAGCCCTGGTGTCAGGATGG + Intergenic
976660501 4:87535544-87535566 CCACGGCCAAGGTGTCAGGAGGG + Intergenic
982213762 4:153062741-153062763 TCAAAGTCAAGGTGTCATGAGGG - Intergenic
982831597 4:160068005-160068027 TCACCGCCATGGGGGCCTCAGGG + Intergenic
982976942 4:162075728-162075750 TCACTGCCTTGGTGTGATGATGG - Intronic
992067593 5:73121827-73121849 TCACATCCATGGTCCCATGAAGG - Intronic
993282095 5:85938211-85938233 TCACACCAATGCTGTCATGATGG + Intergenic
1000344628 5:160304469-160304491 TCATCTCCAGGGGGTCATGAGGG + Intronic
1001556081 5:172638108-172638130 TCACCCCCATGGCTTCATGTGGG + Intergenic
1013314089 6:108924583-108924605 TCAAAGGCATGGCGTCATGAAGG + Intronic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1019748820 7:2716186-2716208 TCACAGCCATGCTATGATGAAGG + Exonic
1029114297 7:98229436-98229458 TCAGCCCCATGGTGACATGGAGG + Intronic
1031959627 7:127976913-127976935 TCCCCTACATGGTGTCTTGAGGG + Intronic
1041946471 8:63449344-63449366 TCAGCAGCTTGGTGTCATGAAGG + Intergenic
1051173969 9:14345971-14345993 ACACCGCCATGGTGGCAACATGG + Intronic
1187821952 X:23297356-23297378 ACACCTCCATGTTGTCATCAGGG + Intergenic
1188481396 X:30640175-30640197 ACACTGCCATGGTCTCATCATGG + Intergenic
1189195540 X:39149121-39149143 TCACCTCCATGGTGATCTGAAGG - Intergenic