ID: 1072021187

View in Genome Browser
Species Human (GRCh38)
Location 10:91403814-91403836
Sequence CTGTTAGAATGCTGGACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072021185_1072021187 22 Left 1072021185 10:91403769-91403791 CCTCAGTAAAAGCTGATTATTTC No data
Right 1072021187 10:91403814-91403836 CTGTTAGAATGCTGGACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072021187 Original CRISPR CTGTTAGAATGCTGGACAAC AGG Intergenic
No off target data available for this crispr